Answer:
Dear India (or the person you want to write the letter to)
I am Rupa/Ranjit who lives in Bangalore . While I was driving to your place I saw many young children begging by the road side . I felt sorry for those poor children but could not do much for them . If I were you I would help them and let them live in a warm place like you and your children do . Do you want to live in a place like them and beg for food and money? Do you want your children to suffer like they do? I know that you do not want to be like them and also you might not want to help but you never know if this happens to you one day and you never get help. If you help some one then in return you will get a good deed back .
Thank you
Explanation:
Answer:
By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.
Explanation:
By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:
AAGGGGTGACTCTAGTTTAATATA
You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:
TTCCCCACTGAGATCAAATTATAT
Use the rule and example and fill in the table.
Answer:
The topic, background, camera shot, and camera movement are all captured in each shot of a storyboard. The subject, the principal figure or item in a frame, and the foreground and backdrop of a shot are all contained inside a shot.
Explanation: