1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eva8 [605]
2 years ago
14

Which of the following is true about the Earth’s atmosphere?

Biology
1 answer:
azamat2 years ago
4 0
Two of the above are true
You might be interested in
According to the chart, which substance has the lowest OH- concentration?
SVEN [57.7K]

The correct answer is option (B) lemon juice.

pH refers to the logarithmic scale used to indicate the acidity or basicity of an aqueous solution. It is the negative of the base 10 logarithm of the activity of the hydrogen ion. Solutions with a pH less that 7 are considered acidic and the solutions with a pH greater that 7 are considered to be basic. A pH of 7 is neither an acid nor a base and is considered neutral.

An acid has a high concentration of hydrogen ions (H+)  and a base has a low concentration of hydrogen ions. Higher the hydrogen ion concentration, pH is acidic. Among the given substances, lemon juice has a pH of 2, urine has a pH of 6, tomato juice has a pH of 4 and black coffee has a pH of 5.  Since lemon juice has a pH of 2, it has the lowest –OH ion concentration.

6 0
3 years ago
Read 2 more answers
Carefully read and ans
nlexa [21]

Answer:

Hypotonic solution

Explanation:

hypertonic solution is the one you get when the solute concentration of the water is higher than that of the cells.

isotonic solution is the one you get when the solute concentration of the cell and the water are the same.

hypotonic is the one that you get when the solute  concentration of the cell is higher than that of the waters.

Solute concentration being low reminds me of water. Hypo kind of sounds like hippo and hippos love water. You can use this to memorize the difference between hypertonic and hypotonic solutions.

sorry if the grammer is bad i tried my best.

3 0
3 years ago
What percentage of our DNA is the same as a mouse?
s344n2d4d5 [400]
About 90% of our DNA is the same.
3 0
2 years ago
PLEASE HELP ME ASAP GIVING AWAY 14 POINTS!!!!!!!!!!!!!!!
meriva

Answer:

its b sunlight

Explanation: because why would a plant grow according to pressure gravity or touch.

3 0
2 years ago
Read 2 more answers
Not all members of a species are the same. Every species exhibits (blank)
Ad libitum [116K]
Variation and traits
5 0
3 years ago
Read 2 more answers
Other questions:
  • How did the agreement that no state could stop a fugitive slave form being returned to his or her owner affect slaves?
    6·1 answer
  • Using the crisscross method, what is the chemical formula for the ionic compound created when potassium (K) combines with Sulfur
    10·1 answer
  • A "sticky end" is the result of this process. a. Restriction enzymes reconnecting DNA b. Restriction enzymes cutting DNA c. DNA
    15·1 answer
  • Nos dias de hoje, com todas as doenças virais, bacterianas que acometem a população e incluindo ainda as infecções hospitalares,
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which is the proper order for blood traveling through the systemic circuit? venae cavae Right arrow. arteries Right arrow. venul
    11·2 answers
  • What occurs when molecules move into a cell by fusing with the membrane
    14·1 answer
  • 4.
    8·2 answers
  • Which is a negative effect of hydroelectric power?
    11·2 answers
  • What is the expected size of the world's population in 2050?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!