1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dolphi86 [110]
2 years ago
5

In what type of cell does the cell wall take place of the membrane?

Biology
1 answer:
Ainat [17]2 years ago
6 0

Answer:

A: Plant Cells

Explanation:

the cell membrane is found in all living species, including plants.

You might be interested in
What is an example of capital resource?<br> O workers<br> O oil<br> O machines<br> O forests
Cerrena [4.2K]

Explanation:

machines ..................................

8 0
3 years ago
Read 2 more answers
Where is exponential growth on a logistic curve
Rasek [7]

Answer:

Likewise, logistic growth (that's what the problem is called, the logistic curve is the variable that moves between the Y and X axes) is a refinement of exponential growth.

Explanation:

The exponential function is a valid model for continuous growths or decreases in which the conditions are always equally favorable: increase of the capital entered into a bank, disintegration of radioactive substances ... The populations of living beings begin to grow according to an exponential curve but if there are no catastrophes, they invade their vital space and, due to the limitation of food, etc., their growth is cushioned, not exceeding their limit population. This type of increase, dampened by a saturation level is called logistic growth.

4 0
3 years ago
What is the difference between diplold and haplold cells?
meriva

Answer:

the number of chromosome sets found in the nucleus

Explanation:

7 0
3 years ago
All you need is in the photo <br><br><br>ASAP​
Gnoma [55]

Answer:

D.)

Explanation:

4 0
3 years ago
Read 2 more answers
What is a example of an involuntary action produced by the skeletal muscles?
vampirchik [111]

Answer:

OK

Explanatia

<h3>aagkun edxamplded of f gFssssssssssssssssssssssssssssssssssssssssssssffffffffavvvvvvvvvvvvvvvvvhbswhdssssssssssss</h3>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Mrs.caragill went to the dr. complaining of her right shoulder blade she learned she was having a galbladder attack what kind of
    13·1 answer
  • Explain whether a conformer or a regulator could tolerate a wider range of conditions.
    5·1 answer
  • Explain how the terms bacteria,eubacteria,archaebacteria relate to one another
    15·1 answer
  • Elements in the same periodic table wich has the same number of valence electrons
    7·1 answer
  • Which characteristics define a liquid?
    14·2 answers
  • Describe how your peripheral nervous system and central nervous system were involved in simple activity you performed today
    13·1 answer
  • How are phosphates incorporated into the organic molecules in aquatic plants and animals?
    8·1 answer
  • 28. What specific adaptation has the sub-type of CAM plants derived to reduce the amount of water lost in dry environments?
    14·1 answer
  • When does everyone think the coronavirus will be OVER!!!!
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!