1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
3 years ago
12

How do the principles of strength training contribute to the design of a fitness program?

Health
1 answer:
MrRissso [65]3 years ago
6 0

Answer:

The principles of strength training involve manipulation of the number of repetitions, sets, tempo, exercises and force to overload a group of muscles and produce the desired change in strength, endurance, size or shape.

Explanation:

hope this helps if not let me know have a blessed day

You might be interested in
Why are girls s sesetive over things and guys arent
harkovskaia [24]

Answer:

Explanation:

from my point of view guys dont show there emotions as much because they think theyre to "good and strong" for themselves.Girls show it and express it cause they care

5 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Which is a function of the lymphatic 
Dmitrij [34]
D - the lymphatic system controls fats, it gets rid of toxins in the body
3 0
3 years ago
A major side effect that stress can cause on the gastrointestinal system is __________. A. diminished levels of gastrin, leading
Ksju [112]

Answer:

Between B and C.

Explanation:

3 0
3 years ago
Read 2 more answers
Water in the diet can come from the foods that you eat, as well as liquid foods and beverages. The dietary reference intake for
horrorfan [7]

Answer:

a. Herbal tea  - Good source of water

b. watermelon  - Good source of water

c. Ice cream - Good source of water

Explanation:

Our body is consist of 60% water, and helps in functioning of body cells. water is important for several functions such as controlling body temperature, heart rate,healthy skin, hair, and nails, and blood pressure.

Dehydration can cause fatique and weakness in one's body and can lead to sever diseases as well, so its important to keep our bodies hydrated.

All of the three given below are good sources of water as a dietary source:

a. Herbal tea : Herbal tea is a good source of water as it consist of more amount of water and can help in hydration of body.

b. watermelon : Watermelon is 90% water, so it is one of the rich source of water.

c. Ice cream: Ice-cream is composed of water, milk fat, ice, milk protein, air, and sugar. Water and fat ahs highest percentage in composition of ice-cream and hence is a good source of water.

Hence, all are good sources of water and act as hydrating agents in dietary source.

4 0
3 years ago
Other questions:
  • The principle of ________ entails applying the same letter or number format to all items at the same level to ensure consistency
    9·1 answer
  • Which laws or rules prevent or reduce injury by preventing crashes
    11·2 answers
  • Which of the following injuries is the most severe?
    8·1 answer
  • Describe three reasons for keeping records on cattle
    7·1 answer
  • The body is protected from the threat of disease by the_______ system.
    10·2 answers
  • Your friend wants your advice about his new transformation fitness plan. He has found a plan that sounds promising to him, but h
    5·2 answers
  • How will the methods of communication provided by computer technology improve patient care? Provide several different methods.
    5·1 answer
  • Antibiotics kill harmful bacteria or prevent bacteria from reproducing.<br> T or F
    11·2 answers
  • Which fitness test tests your heart and lungs
    8·2 answers
  • You just found out that a friend's older brother died in a car crash. What would you say to your friend?​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!