1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
3 years ago
10

In the visual analogy of a cell as a factory, what two functions of the nucleus are represented? How are these functions illustr

ated?

Biology
2 answers:
Evgen [1.6K]3 years ago
8 0

It also carries DNA.

ludmilkaskok [199]3 years ago
5 0

The control center of the factory.


You might be interested in
How do the terms enzyme, substrate, and active site relate to each other? ​
USPshnik [31]

Can you put the terms as well, please

5 0
2 years ago
Read 2 more answers
What is the process that adds sediments to a landform called
Tems11 [23]

weathering takes it away

erosion builds up


Deposition is the geological process in which sediments, soil and rocks are added to a land form or land mass. Wind, ice, water, and gravity transport previously weathered surface material, which, at the loss of enough kinetic energy in the fluid, is deposited, building up layers of sediment.

the answer is deposition HOPE THIS HELPS

7 0
3 years ago
Read 2 more answers
Which of the following is the best definition of an unsaturated fatty acid? 8 A. A basic unit of a lipid that consists of single
Furkat [3]
A. Because saturated fatty acids are the ones with no double bonds
6 0
2 years ago
List 1 advantage and 1 disadvantage of a parallel circuit.
Alex777 [14]

Answer:

Advantages would be that, if it were light bulbs that were the output devices linked in parallel, if one bulb broke the others would continue going. Also, the brightness of the bulbs would be greater than the brightness of bulbs in series. Disadvantages are that there could be a risk of fire in some cases.

Explanation:

7 0
2 years ago
PLZZ HELP ME WITH THESE QUESTIONS ASAP!! (15pts)
Advocard [28]

Answer:

C

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Rosy, dr. raymond's patient, came to him with a peculiar condition. she seemed to have lost the ability to use her arm; apparent
    14·1 answer
  • Identify each statement as true or false. Rewrite false statements to make them correct.
    5·2 answers
  • What proportion of emerging diseases is caused by zoonotic pathogens?
    15·1 answer
  • What materials does dna polymerase require in order to synthesize a complete strand of dna? select all that apply. select all th
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • PLEASE HELP ME WILL MARK BRAINLIEST!!!!!!!What is the name of one of the lower chambers of the heart that receives blood from th
    11·2 answers
  • I’ll mark brainlist
    9·1 answer
  • Why is the youngest rock found near mid-ocean ridges?
    8·1 answer
  • What is created by the flow of electric current?
    10·2 answers
  • Which type of organelle in the athlete’s cells supplies the energy for cellular function?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!