1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Agata [3.3K]
2 years ago
15

Organisms in an ecosystem are interdependent. do you think humans have interdependent relationships with other organisms? explai

n your response.
Biology
1 answer:
jeka942 years ago
6 0

Humans have an interdependent relationship with other organisms just like organisms in an ecosystem are interdependent.

<h3>How are organisms interdependent?</h3>

To be interdependent means that the involved parties are mutually dependent i.e. they are reliant on one another.

Living organisms in their natural habitat are dependent on one another for food, space, mate and other resources.

However, humans are also interdependent on other organisms for resources like food, raw materials. For example, we eat plant and flesh derived from other organisms.

Learn more about interdependence at: brainly.com/question/1530206

#SPJ4

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Which of the following is a way viruses do not cause human diseases?
Lapatulllka [165]
The first one I believe
3 0
3 years ago
What is the result of a chromosome condensing
yanalaym [24]
It explodes and disappears
8 0
3 years ago
Which of the following will decrease peripheral resistance?
Anon25 [30]

Can you show me the following??

3 0
3 years ago
Which disease has been eradicated and is no longer a threat to the health of the libyan citizens?
devlian [24]
Malaria is the answer.

Hope it helped!
6 0
3 years ago
Other questions:
  • The land management technique of _____ helps limit topsoil loss.
    7·2 answers
  • Researchers have crossed two true-breeding lines of peas that differ in the color of their leaf tissue: dark green vs pale green
    6·1 answer
  • What is the simplest form of cell division called?
    7·1 answer
  • Which observation do most scientists think supports the big bang theory as a description of the origin of the universe?
    5·2 answers
  • The word theory used in a scientific sense most closely means
    12·1 answer
  • Two black guinea pigs of the same genotype were mated and produced 29 black and 9 white offspring. what would you predict the ge
    12·1 answer
  • What is the relaishionship betwene genes and cromosomes
    8·1 answer
  • What is ATP, and where is most of the high energy stored in
    6·1 answer
  • The process by which ____________ become activated when the ____________ within the discs of the cells are altered by light ente
    13·1 answer
  • what makes up cell membranes and is used to create hormones?(1 point) glucose glucose cholesterol cholesterol starch starch hydr
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!