Answer:
1. Synthesis and repair of muscle tissue
2. Production of ATP
3. Synthesis of glucose
Explanation:
Proteins are primarily used for tissue repairs and synthesis. They are polymers of amino acids used to make hormones, enzymes and other chemicals of the body. Therefore proteins are only reserved for synthesis and repairs of tissues.
During extreme starvation periods when then is no source of carbohydrates and adipose tissues has been depleted/used up, proteins are alternatively used as source of energy in form of amino acids that enters the liver. Tissues such as muscles are protein degraded to provide the brain with energy in form of ketone bodies and glucose, thus the weight loss in people suffering from malnutrition.
Answer:
G1 and G2
Please Mark Brainliest If This Helped!
Answer:
When an impulse reaches the muscle fibres of a motor unit, it stimulates a reaction in each sarcomere between the actin and myosin filaments. This reaction results in the start of a contraction and the sliding filament theory.
Hope this helps! :)
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'