1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
3 years ago
6

Where is the genetic information for the virus located

Biology
1 answer:
MaRussiya [10]3 years ago
3 0
Viral<span> particles, also known as virions, consist of two or three parts: (i) the </span>genetic<span> material made from either DNA or RNA, long molecules that carry </span>genetic information; (ii) a protein coat, called the capsid, which surrounds and protects thegenetic<span> material</span>
You might be interested in
Ok so this is like hard for me I guess but I have a really hard question for the ladies do you ever think it is but it is just ⚪
Sunny_sXe [5.5K]

Answer:

all the time

Explanation:

5 0
3 years ago
Soils, fertilizers, and pesticides erode and are transported by surrounding waterways to a different location. Which of the foll
Montano1993 [528]

The soil, fertilizers, and pesticides eroded by the surrounding waterways are transported via the water to a location different from their former one. These are taken away by the water flow and deposited in the delta area of the river. This delta is a land-form which is formed by the deposition of the similar substances, where the flow of the river is slower.

Hence, the correct answer is 'Option B'.

7 0
3 years ago
What type of cell included all cellular organelles?
Sidana [21]
Organelles within a cell generally include the nucleous, ribosomes, endoplasim reticulum, cell membrane and cell wall. It also includes more cell names.
4 0
3 years ago
Help pleasseeeeeee
Bad White [126]
<span>The water in the ocean would have percolated down into the soil.

</span>
3 0
3 years ago
Read 2 more answers
In your own words compare and contrast primary vs. secondary succession (you need to address the substrate and pioneer species)
faust18 [17]

Answer:

in primary succession the soil is not readily present so, primary succession needs more time to get constitute and the soil is readily present in the secondary succession and hence it requires very less time.

6 0
3 years ago
Other questions:
  • 11)<br> Which of these would be the LEAST LIKELY to increase human capital?
    7·1 answer
  • Biologists find _____ useful because this scientific study gives them much information about an organism based on its classifica
    11·1 answer
  • What factor determines that an oxygen atom can form two covalent bonds while a carbon atom can form four covalent bonds?
    8·1 answer
  • Wolves, a top predator, were reintroduced to Yellowstone National Park in 1995 after a 50-year absence. In a multiyear study, th
    5·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Cuando se fusionan las células apicales de dos hifas, se producen
    13·1 answer
  • Please choose the best description, or definition for Principle of Fossil Correlation. states that rock layers with the same uni
    14·2 answers
  • PLease help! thank you so much!
    6·2 answers
  • An increase in the volume of forests and phytoplankton would lead to a reduction in free "blank" , which in turn could cause a d
    12·1 answer
  • What are some similarities and between Gigantopithecus and humans?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!