1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
2 years ago
10

What are some similarities and between Gigantopithecus and humans?

Biology
1 answer:
Basile [38]2 years ago
6 0

Answer:

Gigantopithecus could stand on its hind legs, and the known jaws of Gigantopithecus widen towards the rear and proposed that this widening occurred to allow for the housing of a trachea‭ (‬the‭ ‘‬windpipe‭’ ‬that connects the lungs to the mouth opening‭) ‬when the skull was placed directly in top of the head like a human and not carried forward like a great ape.‭

You might be interested in
Please answer I'm BEGGING!!!!!!!!!!
FromTheMoon [43]

Nitrogen.


Plants cannot use atmospheric nitrogen directly. Nitrogen from the air must be converted into the different form so plants can absorb it. Thus plants need nitrogen-fixing bacteria to convert atmospheric nitrogen into ammonium, which is available for plants to absorb it.

5 0
2 years ago
Which is an adaptation for cold, snow-covered environments?
Natasha2012 [34]
Thicker Skin, Fur, More Fat Content 
6 0
3 years ago
Read 2 more answers
Why is there so much diversity on Earth
Damm [24]

Answer:

There is a great deal of diversity in life on Earth because the planet has so many different climates that life has adapted to and colonized.

Explanation:

5 0
2 years ago
The fossil record indicates that the earliest hominids most likely originated on which continent?
Brums [2.3K]
The fossil record indicates that the earliest hominids most likely originated in "Africa," since this is the location from which humans eventually migrated to other locations.
7 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
2 years ago
Other questions:
  • Which statement describes how globes represent Earth’s surface?
    12·2 answers
  • Describe how photosynthesis provides food for ecosystems?
    12·1 answer
  • If an organism has 24 chromosomes in each body cell, how many chromosomes would you expect to find in the organisms sex cells?
    13·1 answer
  • Analysis of the second swab has confirmed that the causative organism is Streptococcus pyogenes, a gram-positive organism. Imagi
    10·1 answer
  • What is unique about Carbon
    8·1 answer
  • How is nuclear fuel used to generate electricity?
    12·1 answer
  • Help please! Thank you <3
    8·1 answer
  • The drug 2,4-dinitrophenol (DNP) destroys the proton gradient across the inner mitochondrial membrane. What would be the effect
    6·1 answer
  • How many stages are there in cellular respiration?
    6·2 answers
  • As the number of prey increases the amount of predator decreases<br><br> TRUE or FALSE
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!