1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastaziya [24]
2 years ago
14

Explain how a bird in a tree would be considered commensalism. Provide supporting details in your explanation

Biology
2 answers:
forsale [732]2 years ago
5 0

Answer: A commensal relationship occurs when one species benefits from the close, prolonged interaction, while the other neither benefits nor is harmed. Just like when a bird is on a tree, the tree is not being harmed by the bird or it’s branches of the nest.

Explanation:

butalik [34]2 years ago
4 0

Answer:

Trees and birds have a commensalism relationship. The birds benefit from having a place to build their nests, while the trees are unharmed and not impacted by the bird’s presence.

Explanation:

You might be interested in
when reading a book, the ciliary muscle will __________, the suspensory ligament will __________, and the lens will become more
trapecia [35]
Contract; loosen; rounded
6 0
2 years ago
2. How does oxygen and carbon availability affect
lawyer [7]

Answer:

i would say A. Both are needed as a reactant of cellular respiration.

Explanation:

While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water. While photosynthesis requires carbon dioxide and releases oxygen, cellular respiration requires oxygen and releases carbon dioxide. ... Without oxygen, much less ATP would be produced.Aug 31, 2018

3 0
2 years ago
The Office of Ecology and Natural Resource Conservation works to _______. a. end the use of natural resources b. maintain the su
lara [203]

Answer:

d

Explanation:

7 0
3 years ago
Which of the following levels of organization is lower than the population?
Paladinen [302]

Answer: Organism

Explanation:

3 0
3 years ago
Witch carbohydrate provides energy for cows but only dietary fiber for humans?
iogann1982 [59]
Cellulose. Our bodies as humans lack enzymes to break the cellulose down.
6 0
3 years ago
Read 2 more answers
Other questions:
  • What offspring are expected from mating a roan bull and a roan cow?
    14·1 answer
  • What molecule is the electron acceptor of glycolysis
    9·1 answer
  • How is the degree of oxygenation of the blood related to skin color?
    15·1 answer
  • Describe what happened when the Paramecium populations were mixed in the same test tube.
    15·1 answer
  • After removing 30 of 40 insects from the population of five different colors, the ten that are left come in only two colors, red
    5·1 answer
  • Where will chlorophyll be found in the chloroplast?
    8·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Write a 4 sentence summary of point source pollution.
    11·1 answer
  • Based on what you were told about the
    11·1 answer
  • What is living organ with example??<br>​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!