1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slega [8]
3 years ago
6

Observing the size of a herd of elephants that are all the same species would be an observation at the ___________ level.

Biology
2 answers:
trasher [3.6K]3 years ago
7 0

Answer:

The correct answer is option "population".

Explanation:

In ecology, a population is defined as a group of organisms living in a particular area or region. An observation of a herd of elephants will be a study at the population level, since it is comprised of a limited number of individuals all belonging to the same species. A study of a community would involve observing different species and their interactions, while a study of an ecosystem would involve studying living and non living components over an extensive geographical region.

Law Incorporation [45]3 years ago
4 0

Answer:

population

Explanation:

You might be interested in
The disorder characterized by cells dividing uncontrollably within the body is called
Tems11 [23]
C i believe bc cancer is characterized by uncontrolled cell division
7 0
3 years ago
Read 2 more answers
Im confused please help me!
Harman [31]

Answer:

 The Geographic barrier would have led to speciation in the finches which started from the founder effect where the finches were brought to other areas of the Galapagos. They were separated geographically so they could not mate with each other. Over time, evolution occurs through natural selection and genetic drift. This leads to the population being so different so they have reproductive barriers and can no longer interbreed. They become different species.

Explanation:

Hope this helps you understand better.

5 0
2 years ago
Read 2 more answers
What occurs just before ignition
Sholpan [36]
Hey!

A compression stroke

Hope this helps!
5 0
3 years ago
What is cellular respiration and how does this process ultimately lead to the generation of atp?
BartSMP [9]
Cellular respiration is the metabolic process by which a cell produces usable energy in the form of ATP. In order to accomplish this cells require Glucose and Oxygen to form the reaction which produces ATP and the byproducts of Water and CO2.

In reality its a complex topic however this is the basic form.
8 0
3 years ago
How does non-human life in an urban ecosystem differ from that in an undeveloped forest ecosystem? (Site 2)
DedPeter [7]
Often times, non-human life in an urban ecosystem is more disturbed in a way that changes happen rapidly, such as the soil and plant cover and temperature and water availability
7 0
3 years ago
Other questions:
  • Which of these is the smallest?<br><br> asteroids<br> comets<br> planets<br> meteoroids
    11·2 answers
  • Which of the following correctly explains differences between steroids and enzymes
    9·1 answer
  • The function of a cell wall in a plant cell and the cell membrane in an animal cell are the same and different because
    15·1 answer
  • Every november, tens of thousands of sally lightfoot crabs on christmas island leave their rain forest habitats at the same time
    12·2 answers
  • For about how many years of geological time have humans existed on Earth?
    8·1 answer
  • The form of oxygen that combines three oxygen Adams into each molecule is called
    10·2 answers
  • Which change absorbs heat?
    5·1 answer
  • What happens when ethanol combusts?
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Each genetic outcome of a genetic cross between the same parents is ______ all previous outcomes. multiple choice question.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!