1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mihalych1998 [28]
1 year ago
10

Use the following information to calculate the correct frequencies: In a population of

Biology
1 answer:
Mademuasel [1]1 year ago
6 0

If we have the recessive genotypic frequency, we can calculate the phenotypic frequencies in a population in Hardy-Weinberg equilibrium. The percentage is <u>82%</u>.

<h3>What si the Hardy-Weinberg equilibrium theory?</h3>

The Hardy-Weinberg equilibrium theory states that allelic and genotypic frequencies remain the same through generations in a population that is in equilibrium.  

The allelic frequencies in a locus are represented as p and q. Assuming a diallelic gene,

Allelic frequencies

  • The frequency of the dominant allele f(X) is p
  • The frequency of the recessive allele f(x) is q

Genotypic frequencies after one generation are

• p² ⇒ H0m0zyg0us dominant genotypic frequency,

• 2pq ⇒ Heter0zyg0us genotypic frequency,

• q² ⇒ H0m0zyg0us recessive genotypic frequency.

The addition of the allelic frequencies equals 1

p + q = 1.

The sum of genotypic frequencies equals 1

p² + 2pq + q² = 1

<u>Available data</u>:

18% of individuals express the recessive trait of Syndactyly

Let us say that the dominant allele is A and the recessive allele is a.

  • The dominant allele A codes for normal finger.
  • The recessive allele a codes for webbed finger.

Assuming this gene expresses complete dominance,

  • H0m0zyg0us dominant and heter0zyg0us -AA and Aa- individuals have normal finger.

Their frequency in the population is p² + 2pq.

  • h0m0zyg0us recessive -aa- individuals have webbed finger.

Their frequency in the population is q².

Individuals that express Syndactyly have webbed finger and their genotype is h0m0zyg0us recessive, aa. Their frequency in the population is q².

q² = 18% = 0.18

We can get the frequency of individuals with normal fingers by clearing the following equation,

p² + 2pq + q² = 1

p² + 2pq + 0.18 = 1

p² + 2pq = 1 - 0.18

<u>p² + 2pq = 0.82</u>

<u />

The frequency of individuals with normal fingers is <u>p² + 2pq = 0.82 = 82%.</u>

<u />

The percentage of the population are not Webbed is <u>82%</u>.

You can learn more about the hardy-weinberg equilibrium at

brainly.com/question/16823644

#SPJ1  

You might be interested in
I need help asap in the sculpturing earths surface unit test lesson 9 unit 5
Naddik [55]
Endogenous processes - Under surface of the earth.
Exogenous processes - Above the surface of the earth.
Lithosphere - Is broken into tectonic plates.
Plates - made of thick slabs of rock, compose the crust/ocean crust .

7 major plates - Pacific, North America, South America, Eurasian, Antarctic, indo-Australian
8 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Explain the factors that affect the rate of photosynthesis in the early afternoon.
makvit [3.9K]

Answer:

Several factors can affect the rate of photosynthesis: light intensity. carbon dioxide concentration. temperature.

Explanation:

3 0
2 years ago
How are limes grown?
Lady bird [3.3K]

Answer:off a tree

Explanation:

8 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Other questions:
  • 1.Which of the following correctly describes a reaction that forms a disaccharide from two monosaccharides?
    5·2 answers
  • Blockage of the _____ can reduce blood supply to the brain, causing a stroke.
    14·1 answer
  • Phospholipids make up most of the lipid present both in the body and in food.
    10·1 answer
  • What is the difference between a solution and a suspension?
    8·2 answers
  • Why do scientists assign each organism a universally accepted name?
    6·1 answer
  • Time Remaining 22 minutes 56 seconds00:22:56 Item 9 Time Remaining 22 minutes 56 seconds00:22:56 Production of a neurotoxin that
    12·1 answer
  • What is the “self”? When we say “myself” or “yourself” what are we referring to?
    8·2 answers
  • Enumerate ways on how humans produce sound:Ex:clapping your hands
    11·2 answers
  • Which statement regarding these methods of reproduction is correct?
    12·1 answer
  • Frederick griffith's work with two strains of the same bacteria, one harmful
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!