1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pshichka [43]
2 years ago
15

HELP!!! what should you use to rinse items after cleaning them and before sanitizing them

Biology
2 answers:
Rama09 [41]2 years ago
6 0
Clear,clean water because when you Hand sanitized you need clear clean water.
Hope this help!
Have a good day:)
AnnZ [28]2 years ago
3 0
Clear/Clean water because when u hand sanitize your hands u need clear clean water
You might be interested in
Plants take in carbon dioxide and release _gas.<br> Answer here
Anika [276]

Answer:

They release oxygen so we can breathe

7 0
4 years ago
En los seres humanos, hay cuatro (4) grupos sanguíneos: A, B, AB y O que son el resultado de la combinación de tres alelos
olganol [36]

Answer:.

Explanation:

6 0
3 years ago
Lesson 1:
Kamila [148]

Answer: the core of the earth heats up the more dense part of the mantle making it less dense.<em> </em>When the less dense part of the mantle rises, the more dense part of the mantle falls, and cools off. This motion continues creating convection currents

3 0
3 years ago
Read 2 more answers
Science is limited to investigation of topics for which evidence can be gained through experiments and/or observation.
Illusion [34]

Answer:

Letter A - True

Explanation:

Science is in fact limited to topics in which evidence can be gained through experiments and/or observations.

This happens because to realize science, scientists have to strictly follow the scientific method. And in this method, essential steps are observation, formulation of hypothesis and experimentation.

It is also important to note that not all knowledge can be covered by the scientific method, this does not mean that it is not valid, just that it is not science.

7 0
4 years ago
ASAP 50 POINTS
alex41 [277]

Answer:

The Independent variable would be the pills that are being taken.

Explanation:

The Independent variable is the variable that you control because the Dependent variables depend on what the Independent variable is.

5 0
3 years ago
Other questions:
  • Describe one difference between PCR and recombinant DNA technology
    5·2 answers
  • A scientist has correctly gone through all the possible steps in a dichotomous key, but has not identified an insect. Which most
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which species is an example of an autotroph?
    6·2 answers
  • How much of Earth is covered in water? O A. 50% O B. 95% O C. 75% O D. 25% SEN​
    11·2 answers
  • Which term refers to water having a slightly positive and a slighty negative charge on its ends?
    7·1 answer
  • Pairing of density dependent and density independent
    6·1 answer
  • HELP!!!!
    10·2 answers
  • Which of the following describes the renewability of active solar energy?
    10·2 answers
  • Which describes the correct pairing of DNA bases?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!