1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slega [8]
3 years ago
12

Water helps moderate the climate around large bodies of water. As a result, the temperatures in these areas are milder than inla

nd where the temperatures are more extreme. This is due to water's ____?
Biology
1 answer:
Alina [70]3 years ago
8 0
I just answered this question from a different person but I like helping with science. This is from the water's breeze or air currents. This makes the climate mild while the inland is more extreme because it does not have the breeze. Hopefully this helps :D
You might be interested in
Which cell part would provide electricity
Anastaziya [24]

the mitochondria provides energy

5 0
3 years ago
This is a molecule of glucose, a simple carbohydrate. If this molecule were broken down, would it provide all of the elements ne
Bingel [31]

No, it wouldn't provide all the elements needed to assemble lipids, nucleic acids or proteins.

As in the diagram, the breakdown of glucose molecules will release hydrogen, carbon and oxygen.

As we know that Carbohydrates and lipids are made of only carbon, hydrogen, and oxygen (CHO). Proteins are made of carbon, hydrogen, oxygen, and nitrogen (CHON).

Biomolecules contain elements like carbon, nitrogen, hydrogen, oxygen, sulfur, and phosphorus. Among these  carbon, nitrogen and hydrogen are  found in all biomolecules. Hydrolysis reactions use water to breakdown polymers into monomers, Hydrolysis reactions break bonds and release energy.

To learn more about Biomolecules , here

brainly.com/question/25817353

#SPJ1

4 0
1 year ago
Living things are characterized by several properties, Write these function of life
Y_Kistochka [10]

Answer:

All living organisms share several key characteristics or functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation, homeostasis, and energy processing.

4 0
3 years ago
In what step of the scientific method is information obtained through the senses?
mixas84 [53]
Observation the action or process of observing something or someone carefully or in order to gain information:
3 0
3 years ago
The economy of agrarian society is based on which of these activities
AleksandrR [38]

Answer: Farming

Explanation: Plowing the land is the  first source of wealth.

7 0
3 years ago
Other questions:
  • Which kind of evolution occurs over a relatively short period of time
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Both passive and active transport are used to move molecules into and out of cells. True or False
    10·1 answer
  • The five most prominent pools where carbon is stored include the Earth's crust, oceans, soil, atmosphere, and the ________.​
    15·2 answers
  • Stalagmites ares structures found in caves. They grow very slowly over time.
    6·1 answer
  • Question 10 5 pts Live or Die challenge (multiple answers): you are walking in the woods just with water and a Black Bear lookin
    11·1 answer
  • What factors play a role in how fast, far, or what direction DNA fragments travel for gel electrophoresis?
    6·1 answer
  • If a cell has a cell membrane, it is ...
    15·1 answer
  • List the two vascular tissues that transport materials throughout a plant AND describe what they each transport.
    14·1 answer
  • EdgeProps: A Computational Platform for Correlative Analysis of Cell Dynamics and Near-Edge Protein Activity
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!