1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
almond37 [142]
3 years ago
15

all the major organs of the body are formed by week 10 of gastrulation which process makes this possible

Biology
1 answer:
OLEGan [10]3 years ago
3 0
The process known as differentiation
You might be interested in
Emergency pleaseeee answer someone!!
FromTheMoon [43]

Answer:

I think the answer is

C.they can burn or damage plants.

8 0
2 years ago
Consider this animal cell. Which organelles are labeled G? centrioles
kvasek [131]

Answer:

The given cell represents an animal cell, in which the organelle labelled as 'G' is mitochondrion. Mitochondria are membrane-bound organelles and their inner membrane is folded inward to form finger-like structures or cristae.

The mitochondria are known as the powerhouse of the cells as they are site for biochemical reactions of respiration and energy production.

Thus, the correct answer is 'mitochondrion.'

5 0
2 years ago
How does soil erosion damage soil?
inessss [21]

Answer:

Soil erosion affects soil health and productivity by removing the highly fertile topsoil and exposing the remaining soil. It decreases agricultural productivity, degrades ecosystem functions and amplifies hydrogeological risk, such as landslides or floods

Explanation:

4 0
3 years ago
Read 2 more answers
Organisms without exonuclease activity would replicate somewhat faster than other organisms, since time would not be spent check
podryga [215]

This is true that The mutation rate would also be higher.

<h3>What is mutation?</h3>

A mutation is a change in the nucleic acid sequence of an organism's, virus's, or extrachromosomal DNA's genome. DNA or RNA can be found in the viral genome.

Environmental elements known as mutagens are what trigger mutations. Radiation, chemicals, and pathogenic agents are examples of mutagens. Mutations may occur naturally spontaneously.

Because it generates a new DNA sequence for a particular gene, the mutation is crucial in the initial stage of evolution because it results in the creation of a new allele. Through intragenic recombination, recombination can also produce a new DNA sequence (a new allele) for a particular gene.

To know more about mutation refer to:  brainly.com/question/9598940

#SPJ1

6 0
2 years ago
Which statement describes the manner in which an animal such as a deer or rabbit gets and uses energy?
Artist 52 [7]

B. It eats plants and converts the sugar in plants to ATP by cellular respiration.

8 0
3 years ago
Read 2 more answers
Other questions:
  • The following ORs are reported for several hypothetical examples. Give you interpretation of the results, assuming all results a
    7·1 answer
  • Bnmbvjhvhgfgcvxgfcbhjv
    11·1 answer
  • Write a paragraph describing a unicorn, what it looks like, and where it lives. Think of any inherited traits the species has th
    15·1 answer
  • _____ refers to the special bond that develops between an infant and his or her primary caregivers and provides the infant with
    7·1 answer
  • Which best describes the process of conduction?
    10·1 answer
  • About when did the first limbs evolve in tetrapods (land-dwelling vertebrates)?
    6·1 answer
  • Why is the use of coal declining in the United States?
    13·1 answer
  • What happens to the enzyme activity of A after 30 degrees
    8·1 answer
  • I HAVE ALREADY CHOSEN THE T-REX
    7·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!