1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yawa3891 [41]
2 years ago
11

When performing a self rescue, when should you swim to shore?.

Biology
1 answer:
AnnyKZ [126]2 years ago
7 0

Self rescue when being done should involve an individual choosing to swim to shore as the last option.

<h3>What is Self rescue?</h3>

These are different forms of methods which are done by individuals to pull out of dangerous situations which may cause them being stranded.

It is always best to get to the shore through every possible means so as to prevent drowning and other unpleasant situations thereby making it the correct answer.

Read more about Self rescue here brainly.com/question/4850006

#SPJ4

You might be interested in
MODEL VERSUS REAL LIFE QUICK CHECK ANSWERS!!! FREEEEEEEE
Korvikt [17]
Yep, your answers look good to me nice job
3 0
3 years ago
Read 2 more answers
What type of cells are bacteria cells? Explain how they are different than animal and plant cells. (Explain 3 differences)
fomenos

Bacteria cells are prokaryotic...

Difference than other cells

1) They do not have a well organized nucleus

2) They do not have a membrane bound organelles

3) They do not have the cell wall.

6 0
3 years ago
Read 2 more answers
Where can you find carbon.
mixas84 [53]

Answer:

in burning charcoal

Explanation:

7 0
3 years ago
In the biology lab, you have just finished a dissection, you should do all of the following EXCEPT?
photoshop1234 [79]
In the biology lab, you have just finished a dissection, you should do all of the following EXCEPT Wrap your specimen in the original wrapping and give to your instructor to dispose of. Thank you for posting your answer here. I hope it helps. 
6 0
4 years ago
Read 2 more answers
What do chromosomes contain?
OlgaM077 [116]
A. DNA molecules, I think
5 0
4 years ago
Other questions:
  • Mention the tools that have been used for tracing evolutionary relationship of humans
    15·1 answer
  • The type of muscle found in the walls of hollow organs, such as the stomach, and in the walls of blood vessels is
    5·1 answer
  • Which of the following is the most likely reason that a population of mice in a farming area suddenly increases?
    5·2 answers
  • The ______ period ended in the greatest extinction of the phanerozoic eon.
    10·1 answer
  • From where does water come to our home ​
    10·2 answers
  • 24. Heat is not typically used after an injury until how many hours have passed?
    7·2 answers
  • Which scenario would most likely result in cooperative hunting?
    9·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Darren is using tongs to carefully lift and move a beaker. What most likely happened before Darren moved the beaker?
    7·1 answer
  • __________________________ is a hybrid of pure and applied science. academic research technoscience industrial research biotechn
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!