1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kykrilka [37]
2 years ago
8

(c) Wheat is another member of the grass family. Wheat grain is used to produce flour.

Biology
1 answer:
tester [92]2 years ago
6 0

It is better to use the mass of the whole plant as the photosynthetic measure because grains only represent a fraction of the weight.

<h3>What is photosynthesis?</h3>

Photosynthesis is a series of chemical reactions that plants use to produce carbohydrates (biomass) by using light energy.

Photosynthesis is responsible to generate all plant biomass, including the comestible fraction of the plant.

In conclusion, it is better to use the mass of the whole plant as the photosynthetic measure because grains only represent a fraction of the weight.

Learn more about photosynthesis here:

brainly.com/question/19160081

#SPJ1

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Which mineral do you think is the most important ,why
11Alexandr11 [23.1K]
In my opinion, I think that coal is the most important mineral of all. It keeps us warm during winter and it helps train transport food and other goods that we need.

Hope We Helped You!!! :-)

Have A Wonderful Day!!!
8 0
3 years ago
Read 2 more answers
I need help on those two questions
Romashka [77]
6-C (breaks off)
7-C(they secrete acid that breaks away rocks)
4 0
3 years ago
What is the function of prothrombinase and thrombin?
max2010maxim [7]
To convert factor I (fibrinogen) into a fibrin clot
6 0
4 years ago
Can someone one please help me
Artemon [7]

Explanation:

2 is B, 6 B ,7 A that's I know I hope this may help you

6 0
3 years ago
Other questions:
  • What are the atoms that make up carbohydrates
    8·2 answers
  • What is the life cycle of a butterfly?
    7·2 answers
  • What the answer to this question?
    7·1 answer
  • When is it appropriate to use a line graph, bar graph and a pie chart?
    13·1 answer
  • Piper touches a block of ice, and she feels that it is very cold. How does she feel the sensation of cold?
    7·1 answer
  • In humans, oculocutaneous (OCA) albinism is a collection of autosomal recessive disorders characterized by an absence of the pig
    11·2 answers
  • During which phase of the cell cycle do the replicated chromosomes thicken and become visible
    9·2 answers
  • I need to know the answers to these
    6·1 answer
  • 3. If tall eyeballs (T) are dominant to short eyeballs(t),
    14·1 answer
  • Help will give brainliest
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!