The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
B. 50 milliers because it just is
Lamarck is best known for his Theory of Inheritance of Acquired Characteristics: If an organism changes during life in order to adapt to its environment, those changes are passed on to its offspring. He said that change is made by what the organisms want or need. For example, Lamarck believed that elephants all used to have short trunks. When there was no food or water that they could reach with their short trunks, they stretched their trunks to reach the water and branches, and their offspring inherited long trunks. Lamarck also said that body parts that are not being used, such as the human appendix and little toes are gradually disappearing. Eventually, people will be born without these parts. Lamarck also believed that evolution happens according to a predetermined plan and that the results have already been decided. Lamarcks theory has been disproven and shows that acquired traits are not passed on to offspring.
