1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
musickatia [10]
1 year ago
5

1. The greatest concentration of minerals in Arizona surrounds this city:

Biology
2 answers:
tekilochka [14]1 year ago
4 0

The greatest concentration of minerals in Arizona in found in the city called Flagstaff.

Arizona is one of the most dense and prolific states in the USA for mineral and rock collectors.

It is incredibly diverse in terms of geology.

Minerals like copper, gems, crude perlite, molybdenum, silver, zeolites and more are present here in a very abundant amount.

The best places to collect minerals in Arizona includes area surrounding the cities namely, Flagstaff, Phoenix, Tucson, Clifton, Morristown and Kingsman. But the area with highest concentration those minerals is the near Flagstaff.

Learn more about Minerals here

brainly.com/question/15844293

#SPJ10

timofeeve [1]1 year ago
3 0

Answer:

Flagstaff

Explanation:

Got the answer correct

You might be interested in
Where are all lemurs find
DIA [1.3K]

Answer:Madagascar

Explanation:Lemurs are primates found only on the African island of Madagascar and some tiny neighboring islands. Because of its geographic isolation, Madagascar is home to many amazing animals found nowhere else on Earth.

8 0
3 years ago
Read 2 more answers
True or false. The absence of a trait cannot be used as a synapomorphy in phylogenetic analysis
kolbaska11 [484]

Answer:

False

Explanation:

Phylogenetic analysis is a means of establishing evolutionary relationships.

Synapomorphy is a shared ("syn") character that is different from the form found in an ancestor that distinguishes a clade (monophyletic group)from other organisms

The absence of a trait can be used as a synapomorphy in phylogenetic analysis. For example, the loss of a trait, such as the loss of legs in snakes, can be a valuable synapomorphy for a clade.

4 0
3 years ago
Organic sedimentary rocks are _____. made of dissolved minerals formed from heat and pressure made from the remains of living or
Nitella [24]
The answer is 3. <span>made from the remains of living organisms.

Sedimentary rocks are formed at Earth's surface. They can be clastic, chemical, and organic.
Clastic sedimentary rocks are the result of sedimentation of rocks and mineral fragments. Chemical sedimentary rocks are the result of sedimentation of chemical solutions of dissolved minerals.
<em>Organic sedimentary rocks are made from the remains of living organisms, fossils and corals.</em>
</span>
3 0
3 years ago
QUESTION 7
yuradex [85]

Answer:

C

Explanation:

Prokaryotic cells doesn't have any nucleus, so the first one is incorrect. No cell can function without genetic information, so the last one is incorrect. Plasmids are present only in Eukaryotic cells, so the second one is incorrect. Which leaves the third one as correct.

7 0
3 years ago
What is crossing-over, during what phase does it occur, and what is its significance?
kondaur [170]

Answer:

Crossing over is a biological occurrence that happens during meiosis when the paired homologs, or chromosomes of the same type, are lined up. Hope this helps :)

Explanation:

4 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • When s.t. first started taking lithium, she would have be cautioned to report side effects. which are common side effects of lit
    13·1 answer
  • What are some factors that might cause a cell to be unable to regulate its cell cycle​
    8·1 answer
  • How do cells get the proteins they need from foods
    5·2 answers
  • What offer a source of energy for humans that would not affect the environment?
    14·1 answer
  • 2. How could one change in a DNA nucleotide alter the formation of the translated protein
    5·1 answer
  • Describe the similarities and differences between the cheek cell wet mount and dental plaque wet mount.
    13·1 answer
  • What is the medullary index for an organism that has a medulla width of 2cm and hair shaft width 4cm? Is this organism human or
    9·1 answer
  • Which gas in the atmosphere might decrease?
    12·1 answer
  • Consider the cell body of a neuron. through which types of ion channel might sodium enter the cell body?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!