1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liula [17]
3 years ago
11

An elements atomic number is 106 how many electrons would an atom of this element have

Biology
2 answers:
Leviafan [203]3 years ago
6 0

If an element have atomic number 106 then the number of electrons in it must be 106, because an atom have same number of proton and electrons.

By definition, atoms have no overall electrical charge. That means that there must be a balance between the positively charged protons and the negatively charged electrons. Atoms must have equal numbers of protons and electrons.

harina [27]3 years ago
4 0

106, The atomic number is the number of protons and electrons.

You might be interested in
he typical human adult uses about 160 g of glucose per day, 120 g of which is used by the brain. The available reserve of glucos
evablogger [386]

Answer:

In humans, the major precursors from which glucose can be synthesized from are:

1. glycerol from triacylglycerols

2. glucogenic amino acids from protein.

3. Oxaloacetate formed from CO2

4. Pyruvate foem pyruvate carboxykinase

All there's are routes through which the body obtains glucose to replenish body glucose levels

3 0
3 years ago
Read 2 more answers
Which kind of solution is the concentration of solutes the same inside and outside of the cell?
Readme [11.4K]

Answer:

D. Dynamic equilibrium

Explanation:

Equilibrium is when the amount of solution outside the cell is equal to the amount inside. A dynamic equilibrium is when this homeostasis is kept through a continuing process. Therefore, since homeostasis is constantly being maintained the solution will be equal on both sides of the cell.

7 0
2 years ago
BRAINLIEST <br>Why would coming to land be an advantage to early amphibians?
Luda [366]

it would be kind of an advantage as they breathe air and just stay on land and to get food it can go into the water

5 0
3 years ago
What is the most common cause of collisions boating?
inna [77]
When people don't know how to drive the boat correctly and they loose control.
8 0
3 years ago
Is species singular or plural?
WINSTONCH [101]
Both. You can use it as singular or plural.
5 0
3 years ago
Other questions:
  • The Kingdom Monera has been separated into two domains, the Archaea and the Bacteria. Which of the following was most important
    7·2 answers
  • 1.Describe at least one societal issue that scientists will be able to address using the sequence of the human genome.
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What is a pickle food group​
    13·1 answer
  • Disorders of collagen are characterized by deterioration of connective tissues. Why would you expect such diseases to produce wi
    13·1 answer
  • What determines the shape of a snow crystal?
    5·2 answers
  • Which ope of cell does the strainer best model?
    10·1 answer
  • Which shell adaptation did you choose for part two and why? Discuss the results and the effectiveness of the adaptation.
    8·1 answer
  • Please need help with this biology question (photo)
    11·1 answer
  • please help ill give brainliest :)) A car travels a distance of 385 km in 8 hours. At what speed did it travel?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!