1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vredina [299]
2 years ago
8

You have been working in the garage, adding a coat of varnish to a piece of furniture. You wipe your hands on a shop rag. Becaus

e Varnish, is flammable, which waste category does the rag now belong to?
A: Ignitable
B: Corrosive
C: Reactive
D: Toxic
Biology
1 answer:
8090 [49]2 years ago
8 0

Answer:

A: Ignitable

Explanation:

Remember, ignite means ability to basically catch fire. Since varnish is flammable (can catch fire), it must go in ignitable waste

You might be interested in
Plants get energy from the sun while animals get energy from
IgorC [24]

Answer:

Animals get energy from food.

4 0
3 years ago
Read 2 more answers
How could the extinction of plants have caused the extinction of some animals?
alexandr402 [8]
Some dinosaur only ate plants and no meat. As plants became extinct the dinosaur who ate plants couldn’t get the food they need so they starved.
4 0
3 years ago
What is the main difference between weather and climate? A. Weather refers to temperature and precipitation, whereas climate ref
Nuetrik [128]

D. Weather refers to short-term conditions, whereas climate refers to long-term conditions. hope this helps!

8 0
3 years ago
HERES EVEN MORE POINTS, im giving away points to you guys live you all
Effectus [21]

Answer:

thx

Explanation:

8 0
3 years ago
Read 2 more answers
Maintaining internal conditions within in an organism is a characteristic of life known as _____. metabolism energy cells homeos
natka813 [3]
Homeostasis, it is the process of organisms regulating their internal conditions. <span />
4 0
3 years ago
Other questions:
  • True or false most proteins have blocked amino and carboxyl terminals.
    6·1 answer
  • Most polyploid plants arise as a result of _____.a. Self-fertilizationb. A mutation of gamete formationc. Meiosisd. Mitosise. Hy
    11·1 answer
  • The heat you feel when you put your hands above fire?
    6·1 answer
  • Your life would be most immediately threatened if you suffered destruction of the ______.
    11·1 answer
  • Val pries open her sister's diary and is shocked to read that her sister believe's Val is an anxious, nervous, and tense person.
    10·2 answers
  • How do you call an organisms position in a food chain, which is determined by its feeding relationships?
    14·1 answer
  • You're trying to identify a plant, but have no information on its characteristics, other than the fact
    9·1 answer
  • Coal is formed when layers of plant matter accumulate at the bottom of a body of water and are protected from biodegradation and
    11·1 answer
  • A dog breeder mates a homozygous brown dog (BB) with a homozygous white dog (bb) and all of the puppies are brown (Bb). These pu
    6·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!