1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina1246 [14]
3 years ago
7

8x998 pls helppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp

Biology
2 answers:
antiseptic1488 [7]3 years ago
5 0
7984 will be your answer
photoshop1234 [79]3 years ago
3 0

Answer:

7984

Explanation:

You might be interested in
How much of the human body is made up of skeletal muscle
ale4655 [162]

Answer:

46% for men and 36% for female

Explanation:

This dependent on the gender you are talking about. Overall there are approximately 600 skeletal muscles in the body.

4 0
3 years ago
To assess the frequency of a woman's labor contractions, the nurse would time:
IRINA_888 [86]
The start of one contraction to the start of another
4 0
3 years ago
describe 2 observation of water that provide evidence that water molecules are attracted to one another
boyakko [2]

Answer:

water is polarized

(like attracts like)

seen in meniscus

Explanation:

8 0
3 years ago
H2 is a molecule, but H2O is a _____. diatomic molecule compound neuron photon
ioda

Answer:

Compound.

Explanation:

If a molecule consists of 2 or more elements its a compound.

7 0
3 years ago
Read 2 more answers
What is cancer and how does it relate to the cell cycle
VikaD [51]

Answer:

Cancer is a disease that causes people to fight for their lives.It is part 9f the cell cycle because some people are born with it and some get it when they get older.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Explain the process of mitosis in a tissue culture for normal cells.
    14·1 answer
  • What forms the majority of the plasma membrane of cells
    14·2 answers
  • How does biodiversity depend on a species' ability to reproduce
    15·2 answers
  • Vocabulary ii fill in the blank with the appropriate term. 1. heterotrophs are living things that cannot make their own ________
    5·1 answer
  • After what age should a stool blood test be a standard annual screening test
    6·1 answer
  • 3. What is the difference between all scientists and social scientists? (1 point)
    14·1 answer
  • Kim knows that today’s lab investigation will involve heating liquids over an open flame. Which apparel choice would indicate th
    5·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • I need help,, this should help move my grade up and i currently have an f:)
    13·1 answer
  • Can someone help me plz I need help
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!