1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
____ [38]
2 years ago
12

The molecular bonds between atoms are considered to be _____ in a food item, before you eat it.

Biology
2 answers:
Daniel [21]2 years ago
7 0

Answer:

Chemical energy

<h2>Which form of energy does our food contain? </h2>

Yes, food serves as a basic source of the nutrients and energy needed to maintain and grow the body. Food contains what is referred to as "chemical energy" in terms of energy. This is nothing more than the bonds between the atoms that make up the specific food item, which the body may break down to release energy that it can use to create, repair, and ensure appropriate bodily function. This chemical energy is ultimately sunshine energy, which plants have the extraordinary capacity to use and store in the chemical compounds they produce, mostly in their leaves, using sunlight, water, and atmospheric carbon dioxide. Food does indeed contain energy, but that energy ultimately originates from the sun. Since people have known this for thousands of years, many civilizations revere the sun, along with water, air, and of course fire, as the source of life. For the body to function, energy is required by the muscles, brain, heart, and liver. The food we eat provides us with this energy. Our bodies break down the food we consume by combining it in the stomach with fluids (acids and enzymes). The carbohydrate (sugars and starches) in food is broken down into another form of sugar, termed glucose, during digestion in the stomach. The glucose is absorbed by the stomach and small intestines before being released into the circulation. Upon entering the bloodstream, glucose can either be utilized right away for energy or stored for later use. But in order to utilize or store glucose for energy, our systems need insulin. When insulin is absent, glucose remains in the circulation, which raises blood sugar levels. The glucose is burnt inside of your cells to create heat and adenosine triphosphate (ATP), a chemical that stores and releases energy as the cell requires. Either oxygen is present throughout the process of converting glucose into energy, or it is not. In the mitochondria, which are microscopic structures located in the gel-like fluid that fills every cell, glucose is transformed into energy using oxygen. This conversion results in waste products including water and carbon dioxide as well as energy (ATP, heat). Without oxygen, red blood cells convert glucose into energy because they lack mitochondria. ATP, heat, and lactic acid are produced as a result. Muscle cells also use glucose as a source of energy. Muscle cells are, well, double-jointed when it comes to converting glucose into energy. They can metabolize glucose with oxygen because they contain mitochondria. However, if the muscle cell's oxygen level plummets, the cells can simply convert glucose into energy on their own without it. When you have been working out so hard that you are physically out of breath, this is most likely to occur.

#SPJ2

Alinara [238K]2 years ago
7 0

Answer:

chemical energy

Explanation:

chemical energy is most likely found in foods

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Answer and I will give you brainiliest ​
Aneli [31]

Answer:

colloid

This will be answer

6 0
3 years ago
Read 2 more answers
WILL GIVE BRIANLIEST TO SOMEONE WHO GIVES ALL ANSWERS!!
Vaselesa [24]
They didn’t give you a word bank? It’s fine if they didn’t ill answer it either ways I’m just asking first
6 0
3 years ago
If a government entity wanted to write regulations that might reduce smog, what human activities might they want to focus on?
Scorpion4ik [409]
Industry
Cars
Fuel burning
Use of chlorofluorocarbons
7 0
3 years ago
Explain why a silent mutation might not affect the protein for which it codes
jasenka [17]
Codons that code for the same amino acid are termed synonyms, Silent mutations are base substitutions that result in no change of the amino acid or amino acid functionality when the altered messenger RNA (mRNA) is translated.
7 0
3 years ago
Other questions:
  • 1. Scientists believe that ancient ancestors of all animals were (1 point) A) single-celled prokaryotes that reproduced asexuall
    15·2 answers
  • If u stir salt into boiling water you produce what
    5·2 answers
  • What are the 3 parts of the dna nucleotide?
    13·1 answer
  • Why are formulas used to describe substances
    12·1 answer
  • Causes of over fishing
    8·1 answer
  • Please answer begging you
    5·1 answer
  • Bleh can you help? ill give brainleist to best awnser :3 (if i can)
    11·1 answer
  • In three to five sentences explain how resource scarcity, competition, and the survival of organisms are connected. (4 points)
    13·1 answer
  • The earliest known mineralized structures in vertebrates are associated with .
    7·1 answer
  • Macromolecules are the biological molecules necessary for life. Cells need macromolecules for different functions from energy st
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!