1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stellarik [79]
2 years ago
13

Helpppppppppppppppppppppppppppppppp

Mathematics
2 answers:
Archy [21]2 years ago
8 0

Answer:

A and C

<em>I hope this helps! ^^</em>

<em></em>

kirza4 [7]2 years ago
4 0

Answer:

Choice a

Step-by-step explanation:

It is the only one that satisfies the condition given

You might be interested in
Evaluate the expression (x^5)^3(16x^8)^1/2
Contact [7]

Answer:

8x^23 i think

3 0
2 years ago
HELP PLEASE!
olasank [31]

Answer        

Find out the Area of a triangle .

To proof  

Formula

Area of Triangle

= \frac{1}{2}\times( {x_1(y_{2}-y_{3}) +x_{2}(y_{3} - y_{1})+x_{3}(y_{1}-y_{2})})

Now vertices are D(3, 3) , E(3, −1) , and F(−2, −5) .

= \frac{1}{2} (3\times(-1 +5) + 3\times(-5-3)-2\times(3+1))

Solving the above

= \frac{1}{2}(3\times4+3\times-8 -2\times4)

=\frac{1}{2} (12-24-8)\\ =\frac{1}{2} (-32+12)\\=\frac{1}{2} (-20)

= -10 units²

(Neglected the negative sign as area cannot be negative.)

= 10 units ²

Area of  a triangle is 10 units ²

Hence proved

6 0
3 years ago
Note: Enter your answer and show all the steps that you use to solve this problem in the space provided.
zhannawk [14.2K]

Answer:

y=27;y=−42

Step-by-step explanation:

33−y=6;63+y=21

y=27;y=−42

I hope this helps!

3 0
3 years ago
Read 2 more answers
Which of these numbers are less than 8.1 × 10^-8?
lina2011 [118]
The answer is 3.4×10^-10
8 0
3 years ago
Solving the formula P = 2L + 2W for W is NOT equivalent to which equation?
emmasim [6.3K]

Answer:

3rd one

Step-by-step explanation:

2l + 2w = P

2w = P - 2l

w = P - 2l / 2

7 0
2 years ago
Other questions:
  • A diver begins at 90 feet below sea level. she descends at a steady rate of 6 feet per minute for 6 minutes. then, she ascends 2
    5·2 answers
  • Please help me I’ve been stuck I’ll mark you as brainliest if you answer and give 5 stars
    5·2 answers
  • There are a total of 34 lions and Hyenas. Each lion eats 4 antelope. Each Hyena eats 3 antelope. 117 antelope are eaten. How man
    14·1 answer
  • What is the equation of the graph below?
    6·1 answer
  • Kris wanted to understand whether students at her school were in favor of an extended school day. She surveyed some students and
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Can someone check my answers please
    9·2 answers
  • The following table shows the data collected from a random sample of 100 middle school students on the number of hours they do h
    10·1 answer
  • Order pair for x-3y=6
    11·1 answer
  • Who crreated solved one of the hardest mathe questions in the world.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!