1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Solnce55 [7]
2 years ago
10

When the spine curves inward at the low back this is referred to as

Biology
2 answers:
gulaghasi [49]2 years ago
4 0

Answer: Lordosis

Explanation:

Over [174]2 years ago
4 0
Lordosis is the answer^
|
You might be interested in
What characteristic of water causes water to stick to the side of a test tube?
bazaltina [42]

Answer:

The characteristic of water that makes this liquid stick to the side of a test tube is called capillarity (Claim).

Explanation:

Water (H₂O) is a polar molecule with the ability to generate van der Waals forces, which is explained by the 4 hydrogen bonds it forms to bind to other substances. The consequence of the forces of the molecular bonds are four properties of H₂O, including surface tension, cohesion, adhesion and capillarity.

- <u>Claim</u>: The characteristic of water that makes this liquid stick to the side of a test tube is called capillarity.

- <u>Evidence</u>: Cohesion and adhesion of water are properties that come from the forces of the molecular bonds of water, and whose effect is the ability of water to wet surfaces and adhere to a tube that contains it, the latter due to capillarity. Capillarity also allows water to rise through the roots and stems of plants, through their thin vascular ducts.

- <u>Reasoning</u>: <u>cohesion</u> in water depends on the force of attraction between H₂O molecules, <u>adhesion</u> is the capacity of H₂O molecules to join other different molecules and —together with <u>surface tension</u>— make H₂O molecules close to the walls of a glass tube adhere to it, which represents capillarity.

The effect of capillarity is more evident when the test tube is of a smaller diameter, although capillarity and adhesion to its walls always exist, and to a greater degree than any other substance.

8 0
2 years ago
Members of the phylum ____ are considered by many researchers to be the living plants most closely related to vascular plants, b
DIA [1.3K]

Answer: The answer is Anthocerophyta

Explanation: Anthocerophyta are widespread and occur in the temperate & tropical zones. The species of plants in this phylum have horn-shaped sporophytes which are known as "flower horn". As in other bryophytes, the sporophyte of this phylum remains attached to its parent gametophyte throughout its life, but unlike these other plants, the sporophyte continues to grow throughout its life; this happens as a group of cells at the base of the horn divide repeatedly. They also possess stomates, which exchange gases between the plant and the air.

The mitochondrial genome evolution in Anthocerophyta is closer to that of seed plants but not as dynamic.

7 0
2 years ago
if there are 500 people in a population, and 150 are homozygous HbA/hba, 150 are homozygous hbs/hbs, and 200 are heterozygous hb
sineoko [7]

Answer:

0.547

Explanation:

Given -

Total Population - 500

Individuals with homozygous HbA/hbA genotype - 150

Individuals with homozygous hbs/hbs genotype -150

Individuals with heterozygous hba/hbs genotype -  200

Let us assume the given population is in Hardy Weinberg' equilibrium

The frequency of individuals in the given population with homozygous HbA/hba genotype is equal to number of individuals with homozygous HbA/hba genotype divided by total population.

\frac{150}{500} \\= 0.3

The frequency of hba allele is equal to

\sqrt{0.3} \\= 0.5477

3 0
3 years ago
The musculoskeletal system, a collaboration
oee [108]

Answer:

D. Movement

Hope this helps :)

6 0
2 years ago
What kind of bond is formed when one atom steals an electron from another atom
Delicious77 [7]
Ionic bonds <span>are the type of bonds where there is </span>transfer<span> of electrons from one atom to another.  The electrons are removed and from one atom and attached to  another. A good example is salt which is composed of sodium and chlorine. Sodium readily loses one of its electrons and chlorine readily accepts it. Before losing the electron, sodium has a positive charge, but then becomes negatively charged after giving up the electron. Chlorine has a positive charge before gaining the electron but becomes negatively charged after gaining the electron. These opposite charges between sodium and chlorine attract the two elements together to form the ionic bond.</span>
6 0
2 years ago
Other questions:
  • The production of endogenous very low-density lipoproteins (vldls) is decreased by
    10·1 answer
  • What does an enzyme do?​
    11·2 answers
  • Before scientists can manipulate DNA they must first do a DNA extraction what is done during this process?
    14·1 answer
  • What is the function of the rough endoplasmic reticulum?
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Hi! I need you guys help asap.
    8·1 answer
  • 9. What are the major differences between P and S waves from an earthquake
    13·1 answer
  • decide if each statement is a fact or misconception about the theory of evolution by natural selection
    11·1 answer
  • You are observing a sample of cells in the lab to
    5·2 answers
  • State one importance of breeding in the vicinity of agriculture.​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!