Answer:
1.Are made up of one or more cells
2. Cells
3. Trees
Explanation:
Answer:
Option A, Acquisition
Explanation:
The first stage of learning is known as acquisition. It causes establishment of responses by pairing of Neutral stimulus, conditioning and un-conditioning stimulus. Once the association between a neutral stimulus and conditioned stimulus is established, the responses are acquired.
For example – If a bird is trained to pick a key whenever there is a sound of a bell, then after certain period of time an association will be established between the “ringing of bell” and “picking up of key” activity. Therefore, whenever the bird will hear the ringing sound it will search for key to be picked.
Thus, option A is correct.
I'd say stone tools. Stone can be chiseled or left alone and be used as a weapon to defend one's self, or as a way of getting food.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
Answer:
Haploid cells only have one set of chromosomes - half the number of chromosomes as the parent cell. Before meiosis I starts, the cell goes through interphase. Just like in mitosis, the parent cell uses this time to prepare for cell division by gathering nutrients and energy and making a copy of its DNA.
Explanation:
please mark this answer as brainliest
