1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madam [21]
3 years ago
14

What type of bond keeps each individual DNA strand together?

Biology
1 answer:
bekas [8.4K]3 years ago
7 0
The answer is Hydrogen bonds
You might be interested in
A cell membrane regulates the direction of movement for substances in order to? A. Eliminate the build up of water products. B.
makkiz [27]
C. All of the above
The cell membrane helps maintain the osmotic potential by doing both A and B, it does not make ATP however.
7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Why can only sperm fertilize an egg?
Svetlanka [38]

Answer:

<em>Sperm is the only thing that can combine with a egg to create a living breathing organism </em>

Explanation:

5 0
3 years ago
How many space stations are currently in orbit? <br> A. 1 <br> B. 4 <br> C. 10 <br> D. 15
kykrilka [37]

Answer:

1

Explanation:

7 0
3 years ago
Multiple sperm must reach the egg for fertilization to occur? true or False
Kazeer [188]
The correct answer is false, only one sperm usually reaches the egg for fertilization.
3 0
3 years ago
Read 2 more answers
Other questions:
  • The human appendix an example of
    15·2 answers
  • In organisms with large genomes, inversions are more likely to be tolerated if the breakpoints occur in: reciprocal translocatio
    13·1 answer
  • All of the 20 common amino acids have at least ____ pka values
    12·1 answer
  • Give two examples of organisms that may have coevolved
    15·1 answer
  • Who is Rosalind Franklin?
    7·1 answer
  • A box 10 centimeters high, 5 centimeters long, and 5 centimeters wide. Find the volume of a box with a length of 5 cm, a width o
    12·1 answer
  • ¿QUÉ IONES SE ENCUENTRAN EN EL MEDIO EXTRACELULAR?
    10·1 answer
  • The very structured cells may viewed with a light compound microscope.
    11·1 answer
  • One difference between the chromosomes of prokaryotes and those of eukaryotes is that:
    6·1 answer
  • How can you distinguish between animal and plant cells under the microscope?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!