1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
3 years ago
10

What is the best medicine for the constriction of the vessels rod from brain?

Biology
1 answer:
daser333 [38]3 years ago
3 0
<span>The best medicine for the constriction of the vessels rod from brain is caffeine. Caffeine can be found in various foods and drinks such as coffee, cocoa, cappuccino, frappuccino, soft/energy drinks, chocolate/energy bars, cough syrup, and other medications.

Answer: Caffeine</span>
You might be interested in
Which of the following does not have an effect on enzyme activity?
ziro4ka [17]
Shape of active site
8 0
3 years ago
In the 1700s, Swedish biologist Carl Linnaeus developed a system of classifying organisms in which every organism was given a sc
kramer

Answer:

a

Explanation:

4 0
3 years ago
The article asserts that carbon monoxide is likely the most harmful pollutant in car exhaust. Why is it so harmful? What necessa
zhuklara [117]
Answer:
Step by step explanation
4 0
3 years ago
one reason that electric power plants do not send out electrical energy as a direct current is that direct current can not be tr
777dan777 [17]

This is because direct power has no pulsation (waveform characteristic) that is significant in electromagnetic induction. The gradual increase and decrease of power, at a given frequency, in indirect power is significant in electromagnetic induction. This enables transformers to induce electricity into the secondary coil, from the primary coil, at the core of the transformer.Transformers transform electric power by increasing or decreasing the voltage and current of electricity.






8 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • Your eye color, gender, and hair color are all determined by the DNA in your genes. Where are these genes located?
    11·1 answer
  • What is the largest level of biological study?
    10·1 answer
  • Which part of a lab report would most likely show a line graph of the data collected?
    7·2 answers
  • Although generally not considered to be alive,a _______ is studied alongside other microbes such as bacteria
    7·1 answer
  • Why is the Northern Arctic glacier melting today?
    10·1 answer
  • Consider two species that diverged while geographically separated but resumed contact before reproductive isolation was complete
    12·1 answer
  • 8)
    12·2 answers
  • Cells from a squirrel are considered eukaryotic and bacteria cells are prokaryotic because -​
    10·1 answer
  • if you used a very fine glass needle to pull one chromosome away from the metaphase plate during metaphase, which checkpoint wou
    5·1 answer
  • When collagen in the wall of a blood vessel is exposed as a result of injury, ______ adhere and develop long, spiny pseudopods w
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!