1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
2 years ago
6

How do ATP and NADPH connect light-dependent and light-independent reactions in photosynthesis?

Biology
2 answers:
hammer [34]2 years ago
5 0

Answer:

ATP and NADPH are produced in the light-dependent reactions and used in the light-independent reactions.

Explanation:

The light-dependent phase of photosynthesis includes splitting of water in the presence of sunlight and channeling of electrons into the electron transport chain (ETC) present between PS I and PS II. The proton motive force generated during transfer of electrons through ETC serves in the synthesis of ATP. The electrons reduce the NADP into NADPH.

These ATP and NADPH formed in light-dependent reactions are used during endergonic redox reactions of the Calvin cycle. Hence, ATP and NADPH are produced in the light-dependent reactions and used in the light-independent reactions.

nirvana33 [79]2 years ago
4 0
I believe it's C, made in light-dependent reactions and used in light-independent reactions.
You might be interested in
Question 2 (0.5 points) In the Northern Hemisphere, choose ALL that apply Summer solstice occurs when the Earth's North Pole is
adell [148]

Answer:

In North America, around June 21, Earth tilts on its axis toward the sun, which is Summer Solstice and when the Northern Hemisphere has the most daylight of any time of year. Winter solstice the Northern Hemisphere tilts the farthest away from the sun and when we have the least amount of daylight of any time of the year.

Explanation:

As Earth revolves around the Sun, it rotates on its axis. Sometimes Earth tilts toward the Sun which is when Summer occurs. In the Winter Earth tilts away from the Sun.

8 0
2 years ago
Read 2 more answers
An endothermic reaction is a process
bagirrra123 [75]

Answer:

If the system is the reactants/products, the temperature would increase.

If the system is the surroundings in which the reaction is occuring, the temperature would decrease.

Explanation:

If I helped, a brainliest answer would be greatly appreciated!

7 0
2 years ago
What might stimulate the cephalic phase of gastric secretion?
kiruha [24]

Complete Question:

Which of the following might stimulate the cephalic phase of gastric secretion?

A. stomach distention

B. the production of saliva

C. the thought of food

D. the production and secretion of gastrin.

Answer:

C. the thought of food

Explanation:

Gastric secretion usually occurs in three different phases, namely;

- Cephalic

- Gastric

- Intestinal

The thought of food usually stimulate the cephalic phase of gastric secretion in organisms. The presence of lipids or low pH inhibits Gastric secretion during the intestinal phase.

7 0
2 years ago
Which causes a sea breeze?
vodka [1.7K]

The wind will blow from the higher pressure over the water to lower pressure over the land causing the sea breeze.

This causes the low surface pressure to shift to over the ocean during the night and the high surface pressure to move over the land.

<h2><u><em>Air above land warms quicker than air over water.</em></u></h2>
6 0
2 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
Other questions:
  • Puberty is defined as ________. the production of hormones in the reproductive glands stimulated by the pituitary gland the stag
    11·2 answers
  • What happened to the strips of clay as they were pushed from opposite ends?
    6·2 answers
  • Do a juvenile bearded dragons need a red light at night for heat? If I don’t leave it on will it die? What should i do I’m scare
    14·1 answer
  • Which of the following changes on a daily basis
    6·2 answers
  • What do bacteria have in common with the cells of other living organisms?
    14·2 answers
  • MULTIPLE CHOICE QUESTION
    14·1 answer
  • Describe the steps to complete a dihybrid<br> cross.
    10·1 answer
  • Yeah I have no questions man
    13·2 answers
  • Example of natural system of classifying organisms​
    10·1 answer
  • How many surfaces does an elbow touch in one hour?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!