1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adoni [48]
3 years ago
13

This is found separating the diaphysis and epiphysis on long bones and is where

Biology
1 answer:
Masteriza [31]3 years ago
6 0
B epiphyseal plate
I hope this helps :)
You might be interested in
Water and wind can<br> soil, or carry<br> or carry it away.
luda_lava [24]

Answer:

what are you trying to ask about?

8 0
3 years ago
Read 2 more answers
Planets are round because of gravity.<br> O True<br> O False
jok3333 [9.3K]
Answer:
True, planets are round because of gravity
7 0
3 years ago
Compare and contrast light microscopes, scanning electron microscopes, and transmission electron microscopes. Sort each statemen
podryga [215]

Answer:

<u>Light microscope</u>:

  • use a beam of light to produce magnified images
  • can be used to examine living cells and tissues

<u>Scanning electron microscope</u>:

  • use a beam of electrons to produce magnified images
  • can be used to examine DNA
  • can be used to examine cells

<u>Transmission electron microscope</u>:

  • use a beam of electrons to produce magnified images
  • can be used to examine DNA
  • can be used to examine cells

Explanation:

Light microscope: is a commonly used microscope also known as compound microscope. Magnifies images from 40X upto 1000X. It uses ray of visible light to produce a magnified image. The light microscope can be used to view specimen of both living and dead cells or tissues. However, it doesn't give a detailed view of a specimen like electron microscope.

Scanning electron microscope: It uses electron beam as an illuminating source. It has a much higher resolving power than light microscope because it uses electrons instead of light. It magnifies object upto 500000 times the actual size. Internal structures can also be viewed. However, only dead specimen can be used because the beam of electrons can kill the cells. They are of two types:

  1. <u>Scanning electron microscope(SEM): </u>an electron beam passes over the specimen's surface and displaces electrons which are then focused on  a screen to form an image. Images appear in 3-D
  2. <u>Transmission electron microscope: </u>electromagnets magnify the image by passing beam of electrons through a thin specimen. Images appear in 2-D

7 0
3 years ago
If the battery in the circuit above is 24 v and the resistance is 12ohms what is the current i
Debora [2.8K]

Answer:

2 Ampere

Explanation:

According to Ohm's Law

V=IR

where V is voltage I is current and R is resistance

24=I(12)

I=24/12

I=2 A

5 0
3 years ago
Why is a high use of renewable energy necessary to make hydrogen fuel an environmentally sound alternative?
Elan Coil [88]
Hydrogen is similar to electricity. Although an electric vehicle, for an example, doesn't create any tail pipe emissions from the vehicle, that may not be the case where the electricity was made. If the electricity was made from an old, smoking, worn out gasoline powered generator in order to charge the electric vehicle, the total pollution created would be much more than that made by a regular gasoline car. However, if the electricity is made by an environmentally friendly renewable source, such as solar or wind, then the total pollution created in powering the electric vehicle would be much less, perhaps even zero. 

<span>Hydrogen can be made from electricity or petroleum. If made from petroleum it wouldn't be much different than gasoline because the rest of the petroleum would have to be used somewhere. If the hydrogen is made from electricity then the question again is where is the electricity being made. </span>

<span>Your question is also a good one because it highlights the "high use" of renewable energy. The production and use of hydrogen in less efficient than running just off of electricity. So you'd have to produce a whole lot more electricity to make hydrogen to drive a car a certain distance than to charge a battery-electric car and drive the same distanc</span>
5 0
4 years ago
Other questions:
  • What is used to measure volume?
    10·1 answer
  • Circardian rythm how can it help you sleep
    8·1 answer
  • Which joins amino acid together?
    7·2 answers
  • You and other scientists have been able to get the same results after many experiments. What is this proven data called?
    8·1 answer
  • Ways of controlling malaria in Nigeria​
    14·1 answer
  • Where does extra energy that is absorbed by the Earth go after the sun sets?
    5·1 answer
  • 1. What is one way that cellular respiration benefits plants and animal?
    8·1 answer
  • Most organisms carry out cellular respiration. Which of the following best describes cellular respiration?
    6·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • It was field day at school. The sun was bright and the temperature high. Most of the students wore light colored T-shirts to sta
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!