Digestion is of two types, mechanical and chemical. Food first enters the mouth where it is mechanically digested by the teeth and chemically digested by the enzymes in the saliva. Next, food travels to the pharynx and then the esophagus via peristaltic motion of the muscles. Then the food enters the stomach, where chemical digestion is completed. The broken down food is sent to the small intestine for absorption and then the large intestine to have water removed and then be expelled from the body.
Unicellular definition- A unicellular organism, also known as a single-celled organism, is an organism that consists of a single cell, unlike a multicellular organism that consists of multiple cells. In contrast, even the simplest multicellular organisms have cells that depend on each other to survive.
Multicellular definition- Multicellular organisms are organisms that consist of more than one cell, in contrast to unicellular organisms.
Prokaryote definition- A microscopic single-celled organism which has neither a distinct nucleus with a membrane nor other specialized organelles, including the bacteria and cyanobacteria. In a few organisms called prokaryotes, there is no defined nucleus and the DNA is found throughout the cell.
Eukaryote definition- A eukaryote is an organism whose cells contain a nucleus within a membrane. Eukaryotes vary from single-celled organisms to complex multicellular animals and plants. In fact, most living things are eukaryotes, made up of cells with distinct nuclei and chromosomes that contain their DNA.
Autotroph definition- An organism capable of synthesizing its own food from inorganic substances, using light or chemical energy. Green plants, algae, and certain bacteria are autotrophs.
Heterotroph definition- A heterotroph is an organism that cannot manufacture its own food by carbon fixation and therefore derives its intake of nutrition from other sources of organic carbon, mainly plant or animal matter. In the food chain, heterotrophs are secondary and tertiary consumers.
Hope this helps..
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
I don't know my class did not do this yet
