Hope this helps
A benefit of crossing over is that it maintains genetic diversity within a population, allowing for millions of different genetic combinations to be passed from parents to offspring. Genetic variability is very important to the long-term survival of a species
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Gonadotropin releasing hormones causes the ovaries and testes to greatly increase their production of estradiol and testosterone.
Gonadotropin releasing hormone is a hormone is released from nerve cells in the brain or produced in hypothalamus and transported to the pituitary gland through the blood stream. These hormones are very important in fertility.
Arthropoda and molluscs have open circulatory systems - meaning haemolymph (Their equivalent to blood) directly bathes the tissue, and isn't enclosed in blood vessels, as seen in a closed blood system, as in humans for example.
Answer:
These could be cells taken from any part of the human body
