1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viva [34]
3 years ago
6

Which event occurs during interphone

Biology
1 answer:
Crazy boy [7]3 years ago
7 0

nterphase. The phase of the cycle during which the cells grows and carries out its normal activities is termed interphase. Three major events occur during interphase are: (1) G1, which stands for the first gap phase

You might be interested in
Which statement best explains how enzymes speed up chemical reactions?
Leni [432]
The answer would be D.

Enzymes activity increases as the temperature increase so, therefore the answer would be D.
but to be fair they all would work.
7 0
3 years ago
What are enzymes, and why are they important to living things?
adell [148]

Answer:

They speed up chemical reactions. Without them you wouldn't be alive. They break down macromolecules, and also lower the amount of energy needed for a chemical reaction to happen.

3 0
3 years ago
The poison cyanide binds to the last complex of the electron transport chain and prevents it from accepting electrons. Assuming
Marianna [84]

Answer:

ATP synthesis by oxidative phosphorylation will stop.

Explanation:

Cyanide inhibits cytochrome oxidase that passes electrons to the molecule oxygen. Cytochrome oxidase also pumps two protons from the matrix to the intermembrane space during electron transfer. Inhibition of cytochrome oxidase would not allow the transfer of electrons to oxygen and the whole electron transport chain would be stopped. There would not be any generation of proton concentration gradient to drive the process of ATP synthesis. Hence, ATP synthesis by oxidative phosphorylation will be stopped after cyanide poisoning in aerobic cells.

7 0
3 years ago
Help ASAP !!! OER
True [87]
1.Aa
2.aa
3. Aa
4.aa
50% Aa and 50%aa
7 0
3 years ago
All instructions for proteins, like hemoglobin, are stored in our _______, which is located in a cell’s ______________. This DNA
svlad2 [7]

Answer:

1. DNA

2. Nucleus

3. mRNA

4. Transcription

5. Nucleus

6. mRNA

7. Cytoplasm

8. Ribosome

9. Translation

10. anti-codons

11. codon

12. amino acids

13. protein

Explanation:

Deoxyribonucleic acid or DNA hold all the instructions that make up an organism. It determines the physical structure and even the function of the different cells that make up all organisms.

The DNA are all stored in the NUCLEUS of cells. Typically, eukaryotic cells have a nucleus except red blood cells. The nucleus has a nuclear envelope that keeps the DNA stored inside but it has nuclear pores that allows it to interact with the cytoplasm.

In order for DNA to be replicated, it needs to be turned into messenger RNA, otherwise known as mRNA. The mRNA decodes the DNA in order for the cell to use the code. The process is called transcription.

Transcription is done within the nucleus. Before the cell can understand what to do with DNA, mRNA transcribes to know what information it needs to produce specidic proteins.

Once transcription is done, it will then bring the information out of the nucleus and into the cytoplasm. The cytoplasm is the viscous gel-like solution that holds the organelles of the cell. In the cytoplasm you have ribsomes.

Ribosomes is where protein synthesis takes place, this is why it is called the protein factory of the cell. It is a molecule that is made up of ribosomal RNA, which direct the chemical processes involved in protein synthesis. For protein synthesis to happen, it will need another type of RNA, which is the tRNA.

tRNA is transfer RNA and they translate the mRNA sequence into proteins. tRNA have amino acids attached to it.

Each 3 bases of the mRNA are collectively known as codons. These codons correspond with specific  tRNA that hold the anticodons. These anticodons code for specific amino acids that they also hold.

When they pair up, the tRNA drop off the amino acid which form a chain with the other tRNA amino acids that complete the code. These chain of monomers then make the protein specific to the DNA code that was copied in the beginning.

3 0
3 years ago
Other questions:
  • Which atmospheric layer is least dense? thermosphere stratosphere troposphere mesosphere
    6·1 answer
  • Describe the structure of the cell membrane and explain what materials enter and leave the cell and how each transport method is
    8·1 answer
  • Why do we use ROCK inhibitors in stem cell culture?
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • the phylum with soft bodied animals with a true body cavity and a 3 part body consisting of a foot, visceral mass, and a mantle
    9·2 answers
  • PLEASE HELPPPP !!!!
    11·1 answer
  • Chemical digestion in the small intestine involves ________. a. a significant amount of enzyme secretion by the intestinal mucos
    5·1 answer
  • How are monomers and polymers related?
    6·1 answer
  • Energy carried by waves
    5·1 answer
  • HELP PLS DUE IN LIKE 2 HOURS (PICTURE ATTACHED)
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!