DNA contains its genetic information in the nucleus
Corrected Question:
The picture shows the dihybrid cross of 2 guinea pigs.
1. What is the genotype of the parents?
2. What is the phenotype of the parents?
3. What is the genotype of their baby guinea pig (in the empty box)?
a. BbRr - black rough fur
b. Bbrr - black smooth fur
c. bbRr- white rough fur
d. bbrr - white smooth fur
Answer:
Genotype of parents is BbRr as seen in the cross.
Phenotype of the parents is black rough furred.
The genotype of the baby in the empty box is bbRR.
Option D
<h3><u>
Explanation:</u></h3>
This representation of the genetic crossing is called as Punnet square, after the name of the scientist who discovered this process to denote the probability of finding the required genotype in a statistical way.
Here both the parents are heterozygous black and rough furred, with the genotype of BbRr.
So the gametes from the parents are = BR, Br, bR, and br from both the parents which are represented in the Punnet square.
Thus we can get 16 types of genetic combinations among the offsprings.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Water is produced when electron transport chain