1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRa [10]
2 years ago
12

Which step in cellular respiration happens first?

Biology
2 answers:
Tanzania [10]2 years ago
6 0
In regards to the basic steps, I believe your answer would be Glycolysis.
liq [111]2 years ago
3 0
Glycolysis. <span>This is where one 6-carbon molecule of glucose is broken down into two molecules of the three-carbon</span>
You might be interested in
Where does DNA contain its genetic information?
dmitriy555 [2]
DNA contains its genetic information in the nucleus

7 0
3 years ago
The picture shows the dihybrid cross of 2 guinea pigs.
Pepsi [2]

Corrected Question:

The picture shows the dihybrid cross of 2 guinea pigs.

1. What is the genotype of the parents?

2. What is the phenotype of the parents?

3. What is the genotype of their baby guinea pig (in the empty box)?

a. BbRr - black rough fur

b. Bbrr - black smooth fur

c. bbRr- white rough fur

d. bbrr - white smooth fur

Answer:

Genotype of parents is BbRr as seen in the cross.

Phenotype of the parents is black rough furred.

The genotype of the baby in the empty box is bbRR.

Option D

<h3><u>Explanation:</u></h3>

This representation of the genetic crossing is called as Punnet square, after the name of the scientist who discovered this process to denote the probability of finding the required genotype in a statistical way.

Here both the parents are heterozygous black and rough furred, with the genotype of BbRr.

So the gametes from the parents are = BR, Br, bR, and br from both the parents which are represented in the Punnet square.

Thus we can get 16 types of genetic combinations among the offsprings.

4 0
3 years ago
Nitrogen is the most __________________________________ gas found in the earth’s atmosphere
yan [13]

Answer:

common/abundant

7 0
2 years ago
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
torisob [31]

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

5 0
2 years ago
An organism cultured from a single cell of another organism that is genetically identical to the other organism is called
devlian [24]
Water is produced when electron transport chain
3 0
2 years ago
Other questions:
  • Which of the following is a molecule with more than one element?
    7·2 answers
  • In humans, the allele for red hair, b, is recessive to the allele for brown hair, B. A man and his wife both have brown hair. Th
    8·1 answer
  • Marathon runners typically will eat foods high in carbs 2-3 days before they run the race. This allows them to have large stores
    10·1 answer
  • The inguinal hernia results from enlargement of the opening through which vessels and nerves of the male reproductive system pas
    13·1 answer
  • Which answer choice correctly identifies the diagrams above?
    6·2 answers
  • A woman with normal vision is pregnant from a man with red-green colorblindness. Can they child produce a child that has red gre
    7·2 answers
  • How would you explain to your friends what you are studying in sociology?
    12·1 answer
  • Whoever answers first and it's correct gets 30 points and the brainliest!
    5·2 answers
  • LISA is an example of a(n): A) enzyme assay. B) biological assay. C) binding assay. D) immunological assay E) none of the above
    6·1 answer
  • Hello people ~
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!