1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veronika [31]
2 years ago
9

Dr. Diop is the head of an academic department in a school whose teachers have all been told to teach from home for the next mon

th. She gets them all to have weekly check-ins using web-conferencing software so that they can meet while they’re all at home. This is an example of a ________ team.
Biology
1 answer:
Jlenok [28]2 years ago
3 0

Answer:

This is an exemple os a virtual team.

Explanation:

Virtual Teams are professionals who work together remotely through the internet and other electronic communication resources, so that they can achieve their common goals. They are presented online, where team members use various tools such as video conferences, e-mails and even social networks.

Dr. Diop is the head of an academic department in a school whose teachers have all been told to teach from home for the next month. She gets them all to have weekly check-ins using web-conferencing software so that they can meet while they’re all at home. This is an example of a virtual team.

See more at: brainly.com/question/27954695

You might be interested in
Which of these processes always causes a physical change of the shape of a material?
ratelena [41]

Answer:

a.) burning

Explanation:

8 0
4 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Need help plzzzzzzzzzz
lyudmila [28]

I'm not 100% sure, but

1.) prokaryotic

2.) prokaryotic

3.) eukaryotic

4.) prokaryotic

6 0
3 years ago
Read 2 more answers
When a new paved parking lot is made, it interrupts which part of the water cycle the most?
lapo4ka [179]

Answer:a

Explanation:

8 0
3 years ago
What were the ultimate consequences of wealth inequalities during the 18th century?
amm1812

Answer:

It led to a wide range of protests by the people which brought about revolution

Explanation:

The ultimate consequences of wealth inequalities during the 18th century was wide range of protests by the people which brought about revolution.

This was because of the high poverty rate and difference between the classes in the society as the rich got richer due to policies which favored them while the poor got poorer due to the bad policies which made them register their displeasure and move for a revolution.

3 0
4 years ago
Other questions:
  • What would happen if you wouldn't do experiments in science
    15·1 answer
  • In a tissue type that undergoes a relatively great deal of mechanical stress, like the tissue that lines the intestine, you woul
    10·1 answer
  • A population of deer is defined by _____.
    9·2 answers
  • In which atmospheric layer do humans live most of their lives?
    13·1 answer
  • Shamash is the god of?
    5·2 answers
  • What kind of cell contains DNA and a nucleus?
    7·2 answers
  • DDT:
    11·2 answers
  • If you could be any animal, what would you be? And why?
    11·1 answer
  • An area of land where two major biomes come together is called a(n)...
    11·1 answer
  • An organism’s scientific name consists of which TWO taxonomic groups? (Select the TWO correct answers).
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!