1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anettt [7]
3 years ago
9

Is the hypothesis about ice cream scientifically testable?

Biology
1 answer:
CaHeK987 [17]3 years ago
5 0

Answer:

No, this is not a testable hypothesis.

Explanation:

Hypothesizing regarding ice cream flavor preferences and texture is not scientifically testable since it inquires for a subjective statement from the subject who would be taking part in the experiment. Scientific method is a set of objective steps taken to formulate some conclusion about an observation or a phenomenon.

You might be interested in
Homologous pairs of chromosomes are lined up independently of other such pairs during _____. prophase II telophase II metaphase
andrey2020 [161]
Answer: metaphase l.
8 0
3 years ago
The study of heredity in biology is called​
Kazeer [188]

Answer:

Explanation:

The passing of traits from parents to offspring is known as heredity, therefore, genetics is the study of heredity. This introduction to genetics takes you through the basic components of genetics such as DNA, genes, chromosomes and genetic inheritance. Genetics is built around molecules called

6 0
3 years ago
The animal which is harmed by the other one but not killed immediately:
NARA [144]
Answer : d) parasite

A parasite is an organism that attaches itself to a host (another organism) and while the parasite benefits, the host is being harmed gradually. This is a symbiotic relationship where only one benefits and the other is hurt.
7 0
3 years ago
Read 2 more answers
Use the transparency to describe a food chain that includes a mountain lion and a shrub
Rudiy27

Answer and Explanation:

We know that shrubs are primary producers and mountain lions are secondary or tertiary consumers. Therefore, mountain lion cannot directly feed on shrub rather need a herbivore. Therefore, to develop a food chain including mountain lion and shrub, we need to have at least one herbivore. If we add a deer between these two, the food chain willl be complete. The deer (herbivore) will eat shrub and mountain lion (carnivore) will eat deer. The food chain can be written as follows

<em>Shrub -> deer -> Mountain Lion</em>

5 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Other questions:
  • Define what is meant by the characterization "input-output signaling machines" as applied to neurons. Discuss the extent to whic
    6·1 answer
  • The Animal Functional Genomics Laboratory at Mississippi State University conducts genetic research involving farm animals. The
    9·2 answers
  • It is thought that modern-day humans (Homo sapiens) evolved from the species Homo heidelbergensis approximately 250,000 to 400,0
    6·1 answer
  • Do you think all living organisms have the same types of cells why or why not​
    7·2 answers
  • A ____ refers to the expressed variation of a trait in a population. marine
    11·1 answer
  • What defines the carrying capacity of a particular species?please help
    14·2 answers
  • The principle of beneficence and nonmaleficence instructs psychologists to try to __________ people and refrain from __________
    11·2 answers
  • Before mitosis begins which happens before the nucleus starts dividing
    8·1 answer
  • The carrying capacity of an ecosystem is
    12·1 answer
  • Can someone help me plz asap? I am giving brainliest.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!