1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nina [5.8K]
2 years ago
9

It has been determined that the temperature in an autoclave should reach __________ for sterilization.

Biology
1 answer:
kolbaska11 [484]2 years ago
5 0

The temperature in an autoclave must reach 121° C in order for sterilization to occur.

<h3>Sterilization using autoclaves</h3>

Autoclaves are used to wet-sterilize materials in the laboratory.

In order for the sterilization to be effective, the temperature of the autoclave must reach 121° C.

Also, substances to be sterilized must spend, at least, 30 minutes in the autoclave.

More on autoclaves can be found here: brainly.com/question/6756965

#SPJ1

You might be interested in
Why sex-linked traits appear more often in males than in females.
umka21 [38]
Because for female sex link desease would require X°X° but for male X°Y so during crossing X linked dear are more common in male.
7 0
3 years ago
Read 2 more answers
Can I have any information on cells, anything at all, (facts or something)
Archy [21]
Cell- <span>the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane. Microscopic organisms typically consist of a single cell, which is either eukaryotic or prokaryotic.</span>
8 0
3 years ago
Read 2 more answers
Give an example of when refraction occurs in nature
Alexeev081 [22]

Answer:

a lake where light is being refracted from the water

3 0
3 years ago
What are other biochemical tests for diagnosing bacteria​
Ber [7]

Explanation:

carbohydrate fermentation, methyl red, citric acid utilization, and hydrogen sulfide production

4 0
3 years ago
Which of the following is necessary for the light-independent reactions to proceed?
Yanka [14]

Answer;

C) ATP

Explanation;

-Photosynthesis can be divided into two parts: the light-dependent reactions and the light-independent reactions (also referred to as the "dark" reactions).

-The two products of the light-dependent reactions of photosystem are ATP and NADPH.  The movement of high energy electrons releases the free energy that is needed to produce these molecules.  The ATP and NADPH are used in the light-independent reactions to make sugar.

-The light-independent reactions, or dark reactions, of photosynthesis are chemical reactions that convert carbon dioxide and other compounds into glucose. These reactions occur in the stroma, the fluid-filled area of a chloroplast outside the thylakoid membranes.

8 0
3 years ago
Other questions:
  • Which does not describe a physical change happening to water?
    6·2 answers
  • Ice in a glacier flows somewhat like liquid water. What is the main difference?
    12·2 answers
  • The students are studying for an exam in pharmacology. They know several local anesthetics have been covered along with other fo
    13·1 answer
  • Why has the classification of organisms changed over time?
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which traits make fungi more related to animals than to plants? (4 points)
    7·1 answer
  • Why are only plant cells able to produce food from sunlight?
    15·1 answer
  • Prisms produce the colors of the rainbow through?
    15·1 answer
  • How do they all function together?__________________________________________
    14·1 answer
  • Asking a question for my Lil sis :)
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!