1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ollegr [7]
2 years ago
15

Fossil evidence has been used to understand the movement of continental plates. The figure below shows where fossils of several

species have been found. How would the range
modern organisms today compare to these species?
Biology
1 answer:
Fed [463]2 years ago
3 0

Answer:

The modern organisms would have more muscular bodies

Explanation:

You might be interested in
How can bacteria become drug resistant and how that impacts humans and healthcare ? ⚠️!worth 30 points!⚠️ helppp
Cerrena [4.2K]

Answer:

Antibiotic resistance occurs when bacteria change in response to the use of these medicines. Bacteria, not humans or animals, become antibiotic-resistant. These bacteria may infect humans and animals, and the infections they cause are harder to treat than those caused by non-resistant bacteria

Explanation:

hope this helps :)

5 0
3 years ago
Which would be the beginning of primary succession?
pentagon [3]

Answer:

Trees sprouting after a forest fire.

Explanation:

7 0
3 years ago
Read 2 more answers
No cell wall, round/irregular shape, one or more small vacuoles, centriole, no chloroplasts, cytoplasm, ER, ribosomes, mitochond
miskamm [114]

Answer:

an animal cell

Explanation:

all of these characteristics define an animal cell

7 0
3 years ago
14. What does wind carry around the Earth? _
Novay_Z [31]
Do they have option
6 0
3 years ago
Read 2 more answers
Summarize the similarities and differences of any two phases of mitosis
juin [17]

<span>Mitosis, simply put, is the division of the nucleus of a cell. It is the phase in the cycle of a cell in which the two chromosomes in a cell divide and separate in a nucleus of their own. These chromosomes are completely identical. As a result of mitosis, two identical cells are formed and are known as daughter cells. This process copies and transfers DNA into both the cells that are formed as a result of Mitosis.</span>
7 0
4 years ago
Other questions:
  • A scientist studying wolves near Kirkland Lake
    13·1 answer
  • Match each type of precipitation to the conditions in which it forms.
    15·2 answers
  • Is a cells main function is to produce proteins to be excreted, such as on the pancreas, which organelles would you expect to be
    9·1 answer
  • How do vectors contribute to the spread of disease?
    5·1 answer
  • Which of the following is a dihybrid cross?a. RrMM Rrmmb. RRMM rrmmc. RrMm RrMmd. rrMM RRmme. RrMm rrmm
    10·1 answer
  • About what percentage of the entire existence of Earth have bacteria been alive?
    6·1 answer
  • Question 7
    15·1 answer
  • Match each step of the scientific method with its description.
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is a omnivore I will give brainlest to whoever answered first.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!