1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elanso [62]
3 years ago
5

Pollen is produced in the anthers, which are the _______ organs of flowers.'

Biology
2 answers:
Crazy boy [7]3 years ago
8 0

male organs of a flower
Vilka [71]3 years ago
4 0

The correct answer is male.

You might be interested in
What do producers do with carbon? (little information needed)
alekssr [168]

Answer:

They transform it into oxygen through cellular respiration

Explanation:

4 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which micro-organisms are used to make bread soft and fluffy? Briefly describe how this happens.
Stells [14]

Answer:

Yeast is used to make the bread soft and fluffy . Yeast cells thrive on simple sugars . As the sugars are metabolized , Carbon dioxide and alcohol are released into the bread dough making it rise . So the bread becomes soft and fluffy. The baker made great bread.

Explanation:

8 0
3 years ago
Describe the internal diameter of the aorta.​
Agata [3.3K]

Answer:

In sonographic measurements performed in the transverse view, the diameter of aorta (Ao) constituted 15.7 mm, the longer dimension of the inferior vena cava (IVC1) equaled 28.4 mm and the shorter one (IVC2) – 15.5 mm. In the longitudinal view, Ao equaled 15.3 mm and IVC – 18.8 mm (tab.

5 0
3 years ago
Read 2 more answers
1.
marta [7]

Answer:

hydropower wind and bio mass

Explanation:

the government has registered them as renewable energy

8 0
3 years ago
Read 2 more answers
Other questions:
  • ________ of food can destroy cell membranes and attack dna and proteins, thus preventing microorganism growth.
    7·1 answer
  • Which of the following describes how the winter season affects organisms in the tundra biome?
    6·2 answers
  • Genetics Variation of Traits
    12·1 answer
  • *URGENT**<br> What is the difference between Cytoplasm and Cytosol?
    6·2 answers
  • Which components bond with andenine in a section if double stranded DNA
    6·1 answer
  • What is number 2 &amp; 3 ?
    10·1 answer
  • I am an<br> organism that lives off of and harms its host. What am I?
    12·1 answer
  • 1. Regions of active cell division in plants
    11·1 answer
  • Please help me, I need to finish soon
    14·2 answers
  • Mixing pure O2 into a yeast culture growing on grape juice will cause the yeast to multiply faster and to metabolize the sugars
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!