1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
I am Lyosha [343]
1 year ago
12

What term describes a plant's response to external stimuli like light, gravity, and touch?

Biology
1 answer:
Svetradugi [14.3K]1 year ago
8 0

According to the research, a tropism is a plant's response to external stimuli like light, gravity, and touch.

<h3>What is a tropism?</h3>

It is the response that plants or certain organs of them make to a stimulus that comes from the outside.

There are different classes of tropisms according to the nature of the stimulus, gravitropism, phototropism, heliotropism among others.

Therefore, we can conclude that according to the research, a tropism is a plant's response to external stimuli like light, gravity, and touch.

Learn more about a tropism here: brainly.com/question/9267510

#SPJ1

You might be interested in
Please help don’t have a lot of time
damaskus [11]

The answer would be 8, because in mitosis it creates and identical cell

5 0
2 years ago
What plants in the rainforest do animals eat?
kiruha [24]
All that produce fruits
8 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
During an algal bloom in a local lake, the population of algae increases at a rapid rate and covers the surface of the water. Al
Nat2105 [25]
C. plants don't need oxygen, they need carbon dioxide and PRODUCE oxygen. Animals DO. Need oxygen, I mean.


8 0
3 years ago
_____ blood analysis provides qualitative information such as size, shape, and ratio of one cell type to another.
alexira [117]

Answer: Differential

Explanation:

The differential blood analysis provides information about the different components of the blood.

Analysis of blood is required in order to detect any disease. This test can detect the difference between the normal cell and abnormal cell.

The blood test can diagnose any type of disease like leukemia, any inflammation, cell shape, size and then compare it with normal cells of the body.

5 0
3 years ago
Other questions:
  • What is the angle of incidence if a reflected wave bounces off a mirror with an angle of reflection equal to 55 degrees?
    13·1 answer
  • How are the effects of PKU and Tay-Sachs disease similar ?
    9·1 answer
  • Name one advantage of electron microscopes.
    9·2 answers
  • Which of the following diseases primarily affects children?
    5·2 answers
  • List ten importance of conservation of wildlife​
    10·1 answer
  • What two digestive organs are different between humans and rats? Based on the diet rats, why do you think a rat's digestive syst
    11·1 answer
  • How do you calculate the adjusted amount of energy that is available to organisms that are one trophic level above producers
    15·2 answers
  • Describe what causes convection currents, and how they result in the movement of tectonic plates. The best answer gets brainlies
    13·1 answer
  • What is a type of cell that would contain many ATP molecules?
    10·1 answer
  • Why is the distance of the energy level from the nucleus important in determing the corresponding peak position in the photoelec
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!