An area in the South region Babylonian in present - day Iraq
The chief City of ancient Mesopotamia and capital of the ancient kingdom of Babylonia
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The maxillary bones and mandible are part of A. the facial bones.
In fact, maxillary and mandible are primary bones of the face which also includes, nasal bones, zygoma, and frontal bone.
Both are found in the jaw area. The mandible bone is located near the lower jaw, while the maxilla is found near the nasal portion of the face.
