1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scZoUnD [109]
2 years ago
10

Calcitonin _________ osteoclast activity, which will _________ blood calcium levels.

Biology
1 answer:
-Dominant- [34]2 years ago
3 0

Calcitonin <u>suppress </u>osteoclast activity, which will <u>lowers</u> blood calcium levels.

<h3>What is Calcitonin?</h3>
  • Calcitonin is a hormone secreted by thyroid gland.
  • Calcitonin reduces the concentration of blood calcium level when it is above normal level.
  • This polypetide hormone is made up of 32 amino acid and is mainly produced by C cells of the thyroid gland.
  • In fish, birds and other non-mammalian animals, Calcitonin is produced by cells of the ultimobranchial body.

To learn more about thyroid gland, refer :

https://brainly.in/question/229275#:~:text=Expert%2Dverified%20answer,-question&text=Thyroid%20gland%20is%20a%20large,through%20the%20rate%20of%20metabolism.

#SPJ2

You might be interested in
Tion 1<br> stion 1<br> Uncontrolled cell growth in lung tissue is
sladkih [1.3K]

Answer:

cancer

Explanation:

8 0
3 years ago
A protein that spans the phospholipid bilayer one or more times is
Leona [35]

Answer:

a transmembrane protein

Explanation:

A transmembrane protein spans the phospholipid bilayer one or more times. they are made of amphiphilic phospholipids: phospholipids with a hydrophilic phosphate head and a hydrophobic tail with two fatty acid chains.

7 0
3 years ago
The _____ sits below the stage and varies the field for viewing the specimen.
Sophie [7]

Answer:

Diaphragm

Explanation:

This is also referred to as the iris.it is located under the stage of the microscope. It's main role is to control the quantity of light that gets to the specimen. The diaphragm is adjustable. Each if the 5 holes in the disc have varying diameter. And it is helpful for adjusting contrast and resolution as regarding the specimen

4 0
3 years ago
Suppose a dye for staining cells stains the region where ribosomes are made. what would you expect to see inside the stained cel
ella [17]

The RNA (ribonucleic acid) and the associated proteins forms the ribosomes. These ribosomes are the site of protein synthesis in a cell. Inside the stained cell nucleus, the nucleolus part of the cell can be seen. The nucleolus is the part where the all the ribosomes of the cell are assembled.

Hence, the answer is 'nucleolus'.

5 0
3 years ago
tasha notices that even though she stops pulling the wagon, her brother’s body moves forward. which of newton’s law of motion ex
expeople1 [14]

Answer:

Newton's first law.

Explanation:

The first law, in which an object moves forward in a straight line unless acted on by an outside force. It describes Inertia it the inherent property of the body due to which it opposes any change in its state of motion or rest. So due to Inertia, Tasha's brother's body moved forward.

6 0
3 years ago
Other questions:
  • You are accidentally stuck with a needle used to administer a medication to a patient with a known history of hepatitis B. You h
    11·1 answer
  • Which is an example of passive transport across a cell membrane?
    9·2 answers
  • What is the difference between a monohybrid cross and a dihybrid cross?
    5·1 answer
  • A condition in which there is a lack of rhythm of the heart beat is:
    15·1 answer
  • To test a hypothesis, a scientist designs a(n) _________________.
    15·1 answer
  • If carbon dioxide is completely removed from a plant’s environment, what would you expect to happen to the plant’s production of
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What does the red light component of the spectrum represent?
    15·1 answer
  • What if the function of bio molecules in the cell cycle?
    9·2 answers
  • Why can water be a good insulator within the body of endothermic (warm-blooded) animals?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!