1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
4 years ago
8

Which layer is the youngest

Biology
2 answers:
mamaluj [8]4 years ago
4 0
I think A is the youngest layer, because of the new sediments that fell upon the animal.
Nikolay [14]4 years ago
3 0
I would have to say Layer A 
it is on the top and that means it is the freshest layer 
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Type of material transport that requires energy from the cell
stiks02 [169]
Isn’t it active transport????
5 0
3 years ago
Can someone please help me?
vaieri [72.5K]
A movement of alleles resulting from migration. I hope I helped
7 0
3 years ago
Read 2 more answers
What do buffalo eat during the dry season
Dima020 [189]
Buffalo eat whatever they can find in the woods
6 0
3 years ago
Read 2 more answers
What happens when light strikes green plant pigments? Glucose is split in half. ATP becomes ADP. NADPH becomes NADP Electrons be
Zina [86]

Answer:

Electrons become excited.

Explanation:

Electrons in the chlorophyll get excited and pass on the energy to other electrons.

5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the step of the scientific method that involves test of hypothesis
    13·2 answers
  • The failure of which body systems can cause an immediate problem
    6·2 answers
  • How does wildfire help restore soil nutrients?
    13·2 answers
  • Oi! Bakugo here. I need some help again.
    8·1 answer
  • Decomposers are a necessary part of a healthy ecosystem because they?
    12·2 answers
  • - Which sedimentary rock is CLASTIC and made up of shale?
    9·2 answers
  • Un pedazo del ADN está dada por la siguiente secuenciaGACGA . Cual de las siguientes secuencias corresponden al pareo de este pe
    15·1 answer
  • Which option is a balanced equation for photosynthesis?
    14·1 answer
  • Cells Vs Viruses
    7·1 answer
  • A healthy individual is a carrier of a lethal allele but is unaffected by it. What is the genotype of this individual?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!