1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zarrin [17]
1 year ago
9

Using what you know about mutation, cellular division(mitosis), and DNA replication, explain how damaged DNA in a stem cell coul

d cause a large impact to an organism.
Answer______________
_____________________
____________________
____________________
_______________________
Biology
1 answer:
White raven [17]1 year ago
6 0

Answer:

It could largely impact the way you look.

Explanation:

Since 100% of your DNA decides how you look, if even one thing changes, one part of your look would change. Sometimes it's something big like eye color, or sometimes like a small change in skin color.

You might be interested in
HELP FAST!!!
ExtremeBDS [4]

Answer:

I think that it is C

But is am not sure

5 0
3 years ago
Read 2 more answers
What happens in the light reactions of photosynthesis
abruzzese [7]
The answer is A
Light is captured and stored in vacuoles
3 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
If the water concentration inside a cell is higher than the water concentration outside the cell, water flows out of the cell. T
Leni [432]
Its called osmosis and it only happens with water. now I'm just adding words to be able to post this. its moving down the concentration gradient.
3 0
2 years ago
Hi! I’m on a test and I have to submit it in about 25 minutes. Please help!
8090 [49]

Answer:

Rock Salt crystals

Explanation:

3 0
2 years ago
Other questions:
  • An atom that gains or loses electrons is called
    9·2 answers
  • Which statement best explains why muscle cells and skin cells do not look and act the same?
    12·2 answers
  • How are the order of codons determined?
    9·2 answers
  • On which cell types do antibodies exist as transmembrane proteins?
    10·1 answer
  • Which statement is NOT true about mitosis?
    8·1 answer
  • What is a limitation of using pedigrees for positional cloning?
    8·1 answer
  • A population that grows until it reaches its carrying capacity usually has the shape of what
    6·1 answer
  • The neuron that transmits the impulse is called the ________________, and the cell receiving the impulse is called the _________
    8·2 answers
  • Which of the following life processes is not necessary for an individual organism to survive, but is necessary for the survival
    6·2 answers
  • Select all that apply.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!