1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Len [333]
3 years ago
9

Biology may be defined as the ______ of ________ according to your lesson. o.o

Biology
1 answer:
Phoenix [80]3 years ago
4 0
Biology is the study (2) of life (1)
You might be interested in
What part of the reproductive system is highlighted below?
adell [148]

Answer:

A. Urethra

Explanation:

The part highlighted below is also known as the Urethra, or the tube in which the urine or semen travels in the male reproductive system! :)

8 0
2 years ago
A gamete would correctly be called
xz_007 [3.2K]
A gamete would correctly be called a SEX CELL.
The cells from the male and female parents which combine to form zygote are called gametes. The male gamete is called sperm while the female gamete is called egg. Both sex cells combine together during fertilization to form the zygote.
8 0
3 years ago
The best term to describe the general process by which microorganisms cause diseases is known as
jenyasd209 [6]
<span>Infection is the term used to describe the process through microorganisms that cause diseases. The invasion of a host by a pathogenic microorganism multiplies in the tissues and the reaction of the host to its presence and to its possible toxins and can be caused by bacteria, fungi, viruses, protozoa or prions.</span>
7 0
3 years ago
A nurse made a tragic mistake and hooked a sick patient up to an IV line that included pure water. The contents of the IV bag we
pishuonlain [190]

Answer:

The water is hypotonic to the body of the patients

Explanation:

<em>Pure water is generally hypotonic to the red blood cells in the body of humans. Hence, if a person is hooked up to an IV line that included pure water, the red blood cells in the person's body will take-in water, become turgid, and then start lysing. This will make the person become sick or even cause death in severe cases.</em>

5 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
Other questions:
  • Which is the change in size of a group of organism of the same species over time
    5·2 answers
  • In what material did robert hooke said he saw in cells
    7·1 answer
  • Barnacles are organisms that live in aquatic environments and live stationary lives attached to hard surfaces. Their feathery ap
    15·1 answer
  • Someone plz heeeeelp! Plz
    9·1 answer
  • What is a phenotype?
    13·1 answer
  • Human skin color varies widely around the world, and children do not always exhibit the exact same coloring as their parents. Ba
    12·2 answers
  • If you removed all Hawks from an ecosystem what would happen
    7·1 answer
  • Can someone please answer this correctly. Will give brainliest for right answer....​
    5·1 answer
  • Which statement is part of the Law of Universal Gravitation?
    14·2 answers
  • Why is the ATP generation and<br> degeneration considered a cycle?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!