1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
2 years ago
10

Can someone help me summarize these advantages?

Biology
1 answer:
Pachacha [2.7K]2 years ago
7 0
Modern GM is quicker and more precise than long term plant breeding.
You might be interested in
A cell entering mitosis with a total of 48 chromosomes (24 pairs) will produce two cells, each with a total of __________ chromo
MatroZZZ [7]
Okay so if you divide 4 with 3 you will get 55 so the answer should be 70 
5 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Is plankton biotic or abiotic?
faust18 [17]

Answer:

Explanation:

Not only is the biota important, but the abiotic factors in the ocean are also important because both groups work together. The abiotic factors in the ocean help the ocean to 'work'. For example, phytoplankton (autotrophs) need light, nutrients, CO2 (dissolved gases) to photosynthesize.

4 0
3 years ago
Read 2 more answers
What happens in the G2 phase of the cell cycle?
Basile [38]
A.) The cell prepares for cell division.
3 0
3 years ago
Which type of art is this image?
frutty [35]

Answer:

Graphic Art

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Fossil evidence indicates that Myllokunmingia, the earliest known vertebrate, had feathery gills, skeletal structures thought to
    5·2 answers
  • What do the two molecules below have in common? glucose and fructose
    14·1 answer
  • A disadvantage of using hydroelectricity is select one it is nonrenewable it is a nonrenewable resource it can disturb natural e
    11·1 answer
  • Please help me!!! When cells express different genes, what occurs?
    10·1 answer
  • If the solid, purple line represents a prey population
    6·1 answer
  • What type of rock is made from molten material from inside the earth? Sedimentary Igneous Metamorphic Magma
    7·1 answer
  • What sugars are easily used by our bodies?
    13·2 answers
  • What is an example of a magnetic field line?
    8·2 answers
  • What is the difference between the theory of continental drift and the theory of plate tectonics?
    15·1 answer
  • The genetic code is redundant. What is meant by this statement? (A) A single codon can specify the addition of more than one ami
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!