1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
castortr0y [4]
2 years ago
5

Tspan8 and Tspan8/CD151 knockout mice unravel the contribution of tumor and host exosomes to tumor progression

Biology
1 answer:
Eduardwww [97]2 years ago
4 0

The tetraspanins Tspan8 and CD151 promote metastasis, exosomes (Exo) being suggested to be important in the  cross talk between tumor and host. The contribution of Tspan8 and CD151 to host versus tumor-derived exosome (TEX) activities being not defined, we approached the questions using 3-methylcholanthrene-induced (MCA) tumors from wt, Tspan8ko, CD151ko and Tspan8/CD151 (db)ko mice, implanted into tetraspanin-competent and deficient hosts.

Methods:

Tumor growth and dissemination, hematopoiesis and angiogenesis were surveyed in wild type (wt), Tspan8ko, CD151ko and dbko mice bearing tetraspanin-competent and -deficient MCA tumors. In vitro studies using tumor cells, bone marrow cells (BMC) and endothelial cells (EC) elaborated the mechanism of serum (s)Exo- and TEX-induced target modulation.

Results:

Tumors grew in autochthonous and syngeneic hosts differing in Tspan8- and/or CD151-competence. However, Tspan8ko- and/or CD151ko-tumor cell dissemination and settlement in metastatic organs was significantly reduced in the autochthonous host, and less severely in the wt-host. Impaired wt-MCA tumor dissemination in the ko-host confirmed a contribution of host- and tumor-Tspan8/-CD151 to tumor cell dissemination, delivery of sExo and TEX being severely impaired by a Tspan8ko/CD151ko.

Conclusions:

Tspan8-/CD151-TEX play central roles in tumor progression. Tspan8-/CD151-sExo and TEX contribute by stimulating angiogenesis. Tspan8 and CD151 fulfill these tasks by associating with function-relevant proteins, the additive impact of Tspan8 and CD151 relying on differences in preferred associations. The distinct Tspan8 and CD151 contributions suggest a blockade of TEX-Tspan8 and -CD151 promising for therapeutic intervention.

Learn more about tumor progression :

brainly.com/question/11710623

#SPJ4

You might be interested in
Zones in which interpersonal interactions can take place are known as ____.
asambeis [7]

Zones in which interpersonal interactions can take place are known as proxemics

Edward Hall, a famous anthropologist coined the term ‘Proxemics. He was interested in understanding how humans use space in communication. Thus, proxemics is about the study how humans using space during their communication with others. It is about how close one stand to someone, whether one touches each other and how comfortable we feel are all part of the study of proxemics.

7 0
4 years ago
Which of the following best describes the use of a renewable resource?
igor_vitrenko [27]

Answer: C. Water falls through openings in a dam turning turbine blades that generate electricity. Hope this helps, please rate Brainliest :)

Explanation: Renewable resources are resources that we can keep using without depleting the earths natural resources. Turbines and the waterfall are endless, not using up anything.

4 0
3 years ago
Read 2 more answers
What causes the isopods to move to a specific area?
Ilya [14]

Answer:

Effects on biodiversity at different scales, geographical regions, and environments. Mostly humidity and temperature.

Explanation:

Isopod distribution is tightly connected to available habitats and habitat features at a fine spatial scale, even though different species may exhibit a variety of responses

8 0
3 years ago
How can you control pollution arising from the need for manufactured goods?
MariettaO [177]
We can control pollution by 
(i)   By  Making workplaces no-smoking zones and banning cigarettes advertising.
(ii)   By Strictly penalties for consumers and firms who break the regulations.
(iii)  By Setting minimum standards in the workplace for health and safety.
4 0
3 years ago
Read 2 more answers
what is the resistance of a car light bulb that conducts 0.025 A current when connected to a 12 V car accumulator? Is the curren
tangare [24]

Answer:

R = 480 Ohm

Yes, the current is steady since the power supply is a constant 12V (comming from the battery).

Explanation:

U=I*R

R = U / I

U = 12 V

I = 0.025 A

R = 12 / 0.025

R = 480 Ohm

6 0
4 years ago
Read 2 more answers
Other questions:
  • The conversation between madame valmondé and désirée gives an example of _____. select all that apply.
    15·2 answers
  • Do both lemurs and humans have the trait listed at point D?
    9·1 answer
  • Suppose a gene has three exons, with 570 nucleotides in exon 1, 420 in exon 2, and 810 in exon 3. there is a variant in which ex
    8·1 answer
  • PLEASE HELP WILL MARK BRAINIEST!! 50 POINTS!!!
    15·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The species of plasmodium that cause the disease malaria are found in
    9·1 answer
  • How should we allocate resources so that the whole human population can have enough resources to live
    15·1 answer
  • AYO HELP MEEEEE VBJKEBADHK
    11·1 answer
  • How do fossils of limb structures provide evidence that ancient and modern tetrapods are related
    9·1 answer
  • First, describe why an animal is considered a system. Then, explain why an animal is not considered a technological system. ▲
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!