1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
1 year ago
6

You are preparing to use a reverse transcriptase to create cDNA from a sample containing purified mature eukaryotic mRNA. If you

are preparing a primer using only one type of nucleotide, the primer most likely to be successful would be
Biology
1 answer:
stiks02 [169]1 year ago
4 0

To prepare a primer using only one type of nucleotide for the formation of cDNA, the primer most likely to be successful would be oligo-dT primer.

A primer is a short stretch of nucleotides of either DNA or RNA that bind to the stretch of DNA and also help in its identification.

Oligo-dT primers contain a short stretch of deoxythymidines. It is the most preferred type of primer for synthesizing the cDNA using reverse transcriptase. They have very high specificity and also allows to study various gene pools all simultaneously. They are suitable for m-RNAs containing a poly-A tail in them.

To know more about primers, here

brainly.com/question/14698863

#SPJ4

You might be interested in
The ___________ membrane is also known as the skin.
Arada [10]
Cutaneous membrane also known as the skin
8 0
3 years ago
Read 2 more answers
Which is an example of molecules
BaLLatris [955]

Explanation:

Oxygen is the answer. (option B)

6 0
2 years ago
List three facts you discovered about ecosystem
Colt1911 [192]

Answer:

Google is great sometimes

Explanation:

Type your question in google

8 0
3 years ago
Read 2 more answers
What are reactants in the process of photosynthesis? Check all that apply.
grigory [225]
Water, light energy, and carbon dioxide
5 0
3 years ago
Read 2 more answers
Waat phenotype has the greatest frequency in a trait that follows a normal distribution
Neporo4naja [7]

Answer:

A phenotype is the physical observations of anything, really. For example, lazuli bunting (a bird species) has feathers that range from dull brown to bright blue. the dull brown and bright blue birds are best at mating. adult males are aggressive toward the bluish-brown birds. The greatest frequency here is that 2 seperate colors are able to mate best, yet, the mixed birds are attacked.

Explanation:

I hope this helped,

have a great day.

5 0
3 years ago
Other questions:
  • If earth is considered a " closed system "
    6·1 answer
  • During what stage of the cell cycle do sister chromatids line up in the middle ?
    8·2 answers
  • In what part of the cell does cellular respiration occur
    7·1 answer
  • Ribosomal RNA is produced in the cytoplasm. <br> true or false
    8·1 answer
  • Microbes in the __________ phase of the microbial growth curve are most susceptible to antimicrobial drugs.
    12·1 answer
  • The mucous membrane that lines the eyelids and is reflected over the anterior surface of the eyeball is the conjunctiva is calle
    9·1 answer
  • Which situation can cause positive population growth?
    8·1 answer
  • All claims in science should be supported by
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • WHICH IS SAME IN MEIOSIS AND MITOSIS
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!