1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nasty-shy [4]
3 years ago
9

Receptors for nonsteroid hormones are located in _____. receptors for nonsteroid hormones are located in _____. the extracellula

r fluid the cytoplasm the nucleus the cytosol association with a cell's plasma membrane
Biology
1 answer:
erica [24]3 years ago
7 0
<span>Receptors for nonsteroid hormones are located in _the target cells____. receptors for nonsteroid hormones are located in __the target cells___. the extracellular fluid the cytoplasm the nucleus the cytosol association with a cell's plasma membrane</span>
You might be interested in
What is the water intake of gymnosperms​
ad-work [718]

Answer:

Check down

Explanation:

Gymnosperms, like angiosperms (the flowering plants), differ from seedless plants (like mosses and ferns) in not requiring water for sperm to swim in to reach the egg. This means that the movement of pollen (male gamete) to ovule (female gamete) in seed plants relies on airborne transport, not water transport.

5 0
3 years ago
The fruit fly Drosophila melanogaster is an important model system for studying inheritance in animals and genetic control of an
Snezhnost [94]

Answer:

The correct answer is "strengths: inexpensive, easy to culture, short life cycle, large number of offspring; weaknesses: invertebrate model, some diseases such as immunological cannot be modelled, anatomical features are very different from humans"

Explanation:

The fruit fly <em>Drosophila melanogaster</em> is one of the most used animal model for genetic and biomedical studies. There are many advantages of using Drosophila as model, including that it is very inexpensive to handle, it is easy to culture, it has a short life cycle allowing to observe the changes in phenotype very quickly and its large number of offspring allows to include several repetitions per trait in a study. However, there are some weaknesses of using Drosophila to study human biology. First, obviously the fruit fly is very different from humans, it is an invertebrate and its anatomical features are very different, which makes impossible to model some disorders such as immunological diseases.

7 0
3 years ago
Initial first aid rendered at the scene of a fire includes preventing further injury through heat exposure. which intervention c
Volgvan
Applying ice to a fire victim leads to tissue hypoxia and necrosis because it will change the skin's temperature too fast and may cause frostbite.  The burn could have had removed a layer of skin, leaving the fragile tissue exposed which will be more sensitive to the ice.
8 0
3 years ago
In a communicable disease what passes from one host to another
telo118 [61]
Is spread from one person to another through a variety of ways that include: contact with blood and bodily fluids; breathing in an airborne virus; or by being bitten by an insect.
5 0
3 years ago
Read 2 more answers
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
3 years ago
Other questions:
  • If gnrh release decreases, what will happen to the release of lh and testosterone?
    5·1 answer
  • Which term is used to describe populations that live close enough to interbreed?
    9·1 answer
  • Why do irish potatoes become sweeter when boiled​
    8·1 answer
  • 2. Alleles that are both expressed in a heterozygote are
    10·1 answer
  • The wild-type allele for a gene has more base pairs than the mutated form of the allele. Which type of mutation occurred? base p
    13·2 answers
  • Which statement describes a catastrophe in The Tragedy of Julius Caesar?
    5·2 answers
  • Cechy wspólne człowieka i malpy​
    9·1 answer
  • What is the last part of the digestive system
    12·2 answers
  • What is the size of the giraffe population?
    7·1 answer
  • How does the circulatory and respiratory system work together?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!