1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Soloha48 [4]
1 year ago
6

Truncated titin proteins and titin haploinsufficiency are targets for functional recovery in human cardiomyopathy due to TTN mut

ations
Biology
1 answer:
Lynna [10]1 year ago
4 0

Truncating mutations in TTN, the gene encoding the titin protein, cause 15 to 25% of nonischemic dilated cardiomyopathy (DCM), however it is unclear whether this is due to haploinsufficiency or the presence of truncated titin proteins.

<h3>What is TTN gene?</h3>

The TTN gene codes for the production of titin, a massive protein. This protein is crucial in both the muscles used for movement (skeletal muscles) and the heart (cardiac muscle). Different muscles produce somewhat different copies of titin (known as isoforms).

Titin is a necessary component of structures called sarcomeres within muscle cells. Sarcomeres are the fundamental components of muscular contraction; they are composed of proteins that produce the mechanical force required for muscles to contract. Titin has numerous purposes within sarcomeres. One of the primary functions of the protein is to provide shape, flexibility, and stability to these cell structures. Titin interacts with other muscle proteins, such as actin and myosin, to maintain sarcomere components in place while muscles contract.

learn more about TTN mutation refer:

brainly.com/question/22006806

#SPJ4

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
The independent is which of the following: A. What is measured B. What is changed by the researcher
Illusion [34]

Answer:

B

Explanation:

4 0
3 years ago
The energy of motion is called heat energy<br><br> true or false
pav-90 [236]
The energy of motion is called kinetic energy
5 0
3 years ago
Which classes are included in the group Tetrapoda?.The choices are: Bony fishes, Amphibia, Reptilia, Aves, and Mammalia. . . . A
Sidana [21]

Amphibia, Reptilia, Aves, and Mammalia are included in the group Tetrapoda. The correct answer between all the choices given is the second choice. I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question.

4 0
3 years ago
Read 2 more answers
Petrochemicals include things like _____.
saveliy_v [14]
Petrochemicals include many things, I would say All of the above. Hope this helped! :)
8 0
3 years ago
Other questions:
  • The organic matter in soil is made of ____.
    15·1 answer
  • A medical researcher has obtained a new strain of streptococcus bacteria. it has a generation time of 15 minutes. bacteria repro
    9·1 answer
  • People who are heterozygous for sickle cell disease are generally healthy because they
    6·2 answers
  • Several years ago, fish from Asia were introduced into ponds in the United States. They have rapidly grown in numbers and use up
    7·2 answers
  • 7. Around what latitude would you guess would have the biggest temperature change
    10·1 answer
  • Which of the following correctly matches an organelle and its functions?
    7·2 answers
  • The clearing of forests for construction and the pollution of ecosystems are both examples of
    8·1 answer
  • 11. Calculate the velocity of a mountain climber if that climber is moving southwest
    7·1 answer
  • What is it that the molecules are trying to achieve as a result of passive<br> transport?
    6·1 answer
  • What happens is substrate and enzyme is torn
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!